Search By Other

 Search
 for  
 In 
       ?

miRNA target sites locating at the circular mRNA AS regions of Arabidopsis

Total 16722 records in 558 Pages. Current page: 1
1/558 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    ath-miR8165
    chr03:4683462-4683482
    AT3G14120
    +
    A5BS
    TTCTTCACTTTTGCCTCTGTT
    AATGGAGGCAAGTGTGAAGGA
    miRferno
    AT3G14120|NUP107|MAG2
    2
    ath-miR5645a;ath-miR5645b;ath-miR5645d;ath-miR5645
    chr03:1905680-1905699
    AT3G06290
    -
    A5BS
    CTTAACGACTTAGCTGAATT
    ATTTGAGTCATGTCGTTAAG
    miRferno
    AT3G06290|SAC3B|AtSAC3B|yeast Sac3 homolog B|F28L1
    3
    ath-miR8171
    chr04:15058527-15058547
    AT4G30950
    -
    A5BS
    TCCTACCACTTGTCTACCCAT
    ATAGGTGGGCCAGTGGTAGGA
    miRferno
    AT4G30950|FAD6|FADC|SFD4|fatty acid desaturase 6|FATTY ACID DESATURASE C|STEAROYL DESATURASE DEFICIENCY 4|F6I18
    4
    ath-miR4245
    chr02:419478-419498
    AT2G01910
    +
    A5BS
    ATTGTAAGCTTATACCTTTGT
    ACAAAGTTTTATACTGACAAT
    miRferno
    AT2G01910|ATMAP65-6|MAP65-6|T23K3
    5
    ath-miR4245
    chr02:419478-419498
    AT2G01910
    +
    A5BS
    ATTGTAAGCTTATACCTTTGT
    ACAAAGTTTTATACTGACAAT
    miRferno
    AT2G01910|ATMAP65-6|MAP65-6|T23K3
    6
    ath-miR5658
    chr05:638869-638889
    AT5G02810
    -
    A5BS
    TGTGATCATCATAATAATCAT
    ATGATGATGATGATGATGAAA
    miRferno
    AT5G02810|PRR7|APRR7|pseudo-response regulator 7|F9G14
    7
    ath-miR5658
    chr05:638869-638889
    AT5G02810
    -
    A5BS
    TGTGATCATCATAATAATCAT
    ATGATGATGATGATGATGAAA
    miRferno
    AT5G02810|PRR7|APRR7|pseudo-response regulator 7|F9G14
    8
    ath-miR5658
    chr05:638869-638889
    AT5G02810
    -
    A5BS
    TGTGATCATCATAATAATCAT
    ATGATGATGATGATGATGAAA
    miRferno
    AT5G02810|PRR7|APRR7|pseudo-response regulator 7|F9G14
    9
    ath-miR833b
    chr01:20718343-20718363
    AT1G55490
    -
    A5BS
    CTAGGCTGGTGTCAACAAGCT
    TGTTTGTTGACATCGGTCTAG
    miRferno
    AT1G55490|CPN60B|LEN1|Cpn60beta1|chaperonin 60 beta|LESION INITIATION 1|chaperonin-60beta1|T5A14
    10
    ath-miR833b
    chr01:20718343-20718363
    AT1G55490
    -
    A5BS
    CTAGGCTGGTGTCAACAAGCT
    TGTTTGTTGACATCGGTCTAG
    miRferno
    AT1G55490|CPN60B|LEN1|Cpn60beta1|chaperonin 60 beta|LESION INITIATION 1|chaperonin-60beta1|T5A14
    11
    ath-miR833b
    chr01:20718343-20718363
    AT1G55490
    -
    A5BS
    CTAGGCTGGTGTCAACAAGCT
    TGTTTGTTGACATCGGTCTAG
    miRferno
    AT1G55490|CPN60B|LEN1|Cpn60beta1|chaperonin 60 beta|LESION INITIATION 1|chaperonin-60beta1|T5A14
    12
    ath-miR833b
    chr01:20718343-20718363
    AT1G55490
    -
    A5BS
    CTAGGCTGGTGTCAACAAGCT
    TGTTTGTTGACATCGGTCTAG
    miRferno
    AT1G55490|CPN60B|LEN1|Cpn60beta1|chaperonin 60 beta|LESION INITIATION 1|chaperonin-60beta1|T5A14
    13
    ath-miR156h
    chr02:12268310-12268329
    AT2G28620
    -
    A5BS
    CTGCTCTATTATTTCTGCCA
    TGACAGAAGAAAGAGAGCAC
    miRferno
    AT2G28620|RSW7|RADIALLY SWOLLEN 7|T8O18
    14
    ath-miR156i
    chr02:12268310-12268329
    AT2G28620
    -
    A5BS
    CTGCTCTATTATTTCTGCCA
    TGACAGAAGAGAGAGAGCAG
    miRferno
    AT2G28620|RSW7|RADIALLY SWOLLEN 7|T8O18
    15
    ath-miR172d-5p
    chr02:12268834-12268854
    AT2G28620
    -
    A5BS
    GCTGAATCTAGTTGATCTTGC
    GCAACATCTTCAAGATTCAGA
    miRferno
    AT2G28620|RSW7|RADIALLY SWOLLEN 7|T8O18
    16
    ath-miR5017-5p
    chr02:12268592-12268612
    AT2G28620
    -
    A5BS
    CATTCCATATAGGTAACAGAA
    ATTTGTTACTAATTTGGAATG
    miRferno
    AT2G28620|RSW7|RADIALLY SWOLLEN 7|T8O18
    17
    ath-miR5021
    chr05:3554455-3554474
    AT5G11170
    +
    A5BS
    TGTACGTCTTCTTCCTCTAA
    TGAGAAGAAGAAGAAGAAAA
    miRferno
    AT5G11170|UAP56a|homolog of human UAP56 a|F2I11
    18
    ath-miR158a-3p
    chr05:3553919-3553938
    AT5G11170
    +
    A5BS
    TACTTCGTCTAGTTTTGAGA
    TCCCAAATGTAGACAAAGCA
    miRferno
    AT5G11170|UAP56a|homolog of human UAP56 a|F2I11
    19
    ath-miR835-3p
    chr03:21688255-21688275
    AT3G58640
    -
    A5BS
    CTTTCTTTCCTGCCTTCTCCT
    TGGAGAAGATACGCAAGAAAG
    miRferno
    AT3G58640|F14P22
    20
    ath-miR835-3p
    chr03:21688255-21688275
    AT3G58640
    -
    A5BS
    CTTTCTTTCCTGCCTTCTCCT
    TGGAGAAGATACGCAAGAAAG
    miRferno
    AT3G58640|F14P22
    21
    ath-miR835-3p
    chr03:21688255-21688275
    AT3G58640
    -
    A5BS
    CTTTCTTTCCTGCCTTCTCCT
    TGGAGAAGATACGCAAGAAAG
    miRferno
    AT3G58640|F14P22
    22
    ath-miR5021
    chr03:21690528-21690547
    AT3G58640
    -
    A5BS
    TTTTATTCTTCAGTTTCTCA
    TGAGAAGAAGAAGAAGAAAA
    miRferno
    AT3G58640|F14P22
    23
    ath-miR5997
    chr03:21691760-21691780
    AT3G58640
    -
    A5BS
    CTATTTAGATTCTTGCCTTCA
    TGAAACCAAGTAGCTAAATAG
    miRferno
    AT3G58640|F14P22
    24
    ath-miR5020b
    chr03:21688260-21688280
    AT3G58640
    -
    A5BS
    TCTGACTTTCTTTCCTGCCTT
    ATGGCATGAAAGAAGGTGAGA
    miRferno
    AT3G58640|F14P22
    25
    ath-miR5020b
    chr03:21688260-21688280
    AT3G58640
    -
    A5BS
    TCTGACTTTCTTTCCTGCCTT
    ATGGCATGAAAGAAGGTGAGA
    miRferno
    AT3G58640|F14P22
    26
    ath-miR5020b
    chr03:21688260-21688280
    AT3G58640
    -
    A5BS
    TCTGACTTTCTTTCCTGCCTT
    ATGGCATGAAAGAAGGTGAGA
    miRferno
    AT3G58640|F14P22
    27
    ath-miR861-5p
    chr02:7736188-7736208
    AT2G17790
    +
    A5BS
    TTGACGCCTTTTTTCCCAATG
    CCTTGGAGAAATATGCGTCAA
    miRferno
    AT2G17790|VPS35A|ZIP3|VPS35 homolog A|ZIG suppressor 3|T17A5
    28
    ath-miR823
    chr02:7737348-7737368
    AT2G17790
    +
    A5BS
    ATGTTATATAATGATGACCCA
    TGGGTGGTGATCATATAAGAT
    miRferno
    AT2G17790|VPS35A|ZIP3|VPS35 homolog A|ZIG suppressor 3|T17A5
    29
    ath-miR5647
    chr02:7735854-7735874
    AT2G17790
    +
    A5BS
    TGGAAGCTTTCTCAAAGTTGA
    TCAAGTTTGATGACGATTCCA
    miRferno
    AT2G17790|VPS35A|ZIP3|VPS35 homolog A|ZIG suppressor 3|T17A5
    30
    ath-miR5647
    chr02:7735854-7735874
    AT2G17790
    +
    A5BS
    TGGAAGCTTTCTCAAAGTTGA
    TCAAGTTTGATGACGATTCCA
    miRferno
    AT2G17790|VPS35A|ZIP3|VPS35 homolog A|ZIG suppressor 3|T17A5