Search By Other

 Search
 for  
 In 
       ?

miRNA target sites locating at the circular mRNA AS regions of Arabidopsis

Total 19164 records in 639 Pages. Current page: 1
1/639 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
ath-miR8165
chr03:4683462-4683482
AT3G14120
+
A5BS
TTCTTCACTTTTGCCTCTGTT
AATGGAGGCAAGTGTGAAGGA
miRferno
AT3G14120|NUP107|MAG2
2
ath-miR8171
chr04:15058527-15058547
AT4G30950
-
A5BS
TCCTACCACTTGTCTACCCAT
ATAGGTGGGCCAGTGGTAGGA
miRferno
AT4G30950|FAD6|FADC|SFD4|fatty acid desaturase 6|FATTY ACID DESATURASE C|STEAROYL DESATURASE DEFICIENCY 4|F6I18
3
ath-miR4245
chr02:419478-419498
AT2G01910
+
A5BS
ATTGTAAGCTTATACCTTTGT
ACAAAGTTTTATACTGACAAT
miRferno
AT2G01910|ATMAP65-6|MAP65-6|T23K3
4
ath-miR4245
chr02:419478-419498
AT2G01910
+
A5BS
ATTGTAAGCTTATACCTTTGT
ACAAAGTTTTATACTGACAAT
miRferno
AT2G01910|ATMAP65-6|MAP65-6|T23K3
5
ath-miR5658
chr05:638869-638889
AT5G02810
-
A5BS
TGTGATCATCATAATAATCAT
ATGATGATGATGATGATGAAA
miRferno
AT5G02810|PRR7|APRR7|pseudo-response regulator 7|F9G14
6
ath-miR5658
chr05:638869-638889
AT5G02810
-
A5BS
TGTGATCATCATAATAATCAT
ATGATGATGATGATGATGAAA
miRferno
AT5G02810|PRR7|APRR7|pseudo-response regulator 7|F9G14
7
ath-miR5658
chr05:638869-638889
AT5G02810
-
A5BS
TGTGATCATCATAATAATCAT
ATGATGATGATGATGATGAAA
miRferno
AT5G02810|PRR7|APRR7|pseudo-response regulator 7|F9G14
8
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
9
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
10
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
11
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
12
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
13
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
14
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
15
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
16
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
17
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
18
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
19
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
20
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
21
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
22
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
23
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
24
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
25
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
26
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
27
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
28
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
29
ath-miR1886.3
chr01:3347519-3347539
AT1G10200
-
A5BS
ATTAAGTAGAAATCTTTGAAT
AATTAAAGATTTCATCTTACT
miRferno
AT1G10200|WLIM1|AtWLIM1|WLIM1|F14N23
30
ath-miR833b
chr01:20718343-20718363
AT1G55490
-
A5BS
CTAGGCTGGTGTCAACAAGCT
TGTTTGTTGACATCGGTCTAG
miRferno
AT1G55490|CPN60B|LEN1|Cpn60beta1|chaperonin 60 beta|LESION INITIATION 1|chaperonin-60beta1|T5A14
IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/639 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>