Search By Other

 Search
 for  
 In 
       ?

miRNA target sites locating at the circular mRNA AS regions of Glycine max

Total 528 records in 18 Pages. Current page: 1
1/18 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
gma-miR5043
chr20:24557214-24557234
GLYMA20G17500
+
A5BS
TGGGATGCAGTGAAGGAGACA
TGTCCCCTTCTCTGCACCACC
miRferno
ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
2
gma-miR4341
chr20:24558221-24558244
GLYMA20G17500
+
A5BS
CCTTCAGGTTAAAATTCCAATACG
TGTGTTGAAAGTTTAACATGACGG
miRferno
ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
3
gma-miR1511
chr20:24556830-24556849
GLYMA20G17500
+
A5BS
TATGGTATCAGAGCTCGATC
AACCAGGCTCTGATACCATG
miRferno
ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
4
gma-miR1535a
chr20:24560071-24560089
GLYMA20G17500
+
A5BS
AGTCAGCACCTCAAATAAG
CTTGTTTGTGGTGATGTCT
miRferno
ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
5
gma-miR396c;gma-miR396b-5p;gma-miR396k-5p
chr20:24546104-24546124
GLYMA20G17500
+
A3BS
AACTTAAAGGAGGCTGTGGAT
TTCCACAGCTTTCTTGAACTT
miRferno
ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
6
gma-miR1533
chr20:24547319-24547337
GLYMA20G17500
+
A3BS
TGATTATCATCATTATTAT
ATAATAAAAATAATAATGA
miRferno
ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
7
gma-miR5374-3p
chr20:24547589-24547609
GLYMA20G17500
+
A3BS
GTTTGTGATCAGATATTTGAA
TTCAAATGTCAGATTATAAAA
miRferno
ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
8
gma-miR396h
chr20:24546104-24546123
GLYMA20G17500
+
A3BS
AACTTAAAGGAGGCTGTGGA
TCCACAGCTTTCTTGAACTG
miRferno
ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
9
gma-miR5039
chr19:42942916-42942936
GLYMA19G35410
+
A5BS
GATGAAACAATTACAAAATGG
CCCTTTTTTAATCGTTGCATG
miRferno
MYA2 (ARABIDOPSIS MYOSIN 2); GTP-dependent protein binding / Rab GTPase binding / motor
10
gma-miR9760
chr17:15763034-15763054
GLYMA17G18400
+
A3BS
CAAGCAACTCTGCAGCATCCA
TGGATGATGTAGTTTTGATTG
miRferno
SDN3 (SMALL RNA DEGRADING NUCLEASE 3); exonuclease/ nucleic acid binding
11
gma-miR5761b;gma-miR5761a
chr15:4622076-4622096
GLYMA15G06540
-
A5BS
CAAATGCTAGACGACAGAAGA
TTTTGTGTCGTGAAGCTTTTG
miRferno
magnesium transporter CorA-like protein-related
12
gma-miR1530
chr3:36309060-36309080
GLYMA03G28410
+
A3BS
CTATATGAATTTATGAGAAAA
TTTTCACATAAATTAAAATAT
miRferno
GLU1 (GLUTAMATE SYNTHASE 1); glutamate synthase (ferredoxin)
13
gma-miR1533
chr3:36307650-36307668
GLYMA03G28410
+
A3BS
TTACTATTAGTTTTATCCT
ATAATAAAAATAATAATGA
miRferno
GLU1 (GLUTAMATE SYNTHASE 1); glutamate synthase (ferredoxin)
14
gma-miR408d
chr3:36308280-36308299
GLYMA03G28410
+
A3BS
GGGAGGCAATAGGAAGTGCA
TGCACTGCCTCTTCCCTGGC
miRferno
GLU1 (GLUTAMATE SYNTHASE 1); glutamate synthase (ferredoxin)
15
gma-miR4396
chr3:36310534-36310557
GLYMA03G28410
+
A3BS
GGCAGCATTGTCTCAGAAACCTCA
TGTAGTTTCTAAGACGATGCTGAC
miRferno
GLU1 (GLUTAMATE SYNTHASE 1); glutamate synthase (ferredoxin)
16
gma-miR1521a
chr16:4653761-4653780
GLYMA16G05310
+
A3BS
TAGTCATTTTCCATTAACCA
CTGTTAATGGAAAATGTTGA
miRferno
zinc finger (C3HC4-type RING finger) family protein
17
gma-miR319p
chr18:31739816-31739836
GLYMA18G27710
+
A5BS
GCAACACTCTTCAGGCCAAAA
TTTTGGACTGAAGGGAGCTCC
miRferno
SHM1 (SERINE TRANSHYDROXYMETHYLTRANSFERASE 1); glycine hydroxymethyltransferase/ poly(U) binding
18
gma-miR1534
chr12:5365554-5365573
GLYMA12G07740
+
A5BS
ATGACTGTTTACCTTGAAAA
TATTTTGGGTAAATAGTCAT
miRferno
VHA-A1 (VACUOLAR PROTON ATPASE A 1); ATPase
19
gma-miR156g
chr12:5365310-5365329
GLYMA12G07740
+
A5BS
TTGCCCTTTCTATTTTCTGT
ACAGAAGATAGAGAGCACAG
miRferno
VHA-A1 (VACUOLAR PROTON ATPASE A 1); ATPase
20
gma-miR1512a-3p
chr12:5365570-5365590
GLYMA12G07740
+
A5BS
AAAAACTGAAGTTCTTAAATT
GCTTTAAGAATTTCAGTTATG
miRferno
VHA-A1 (VACUOLAR PROTON ATPASE A 1); ATPase
21
gma-miR159e-3p;gma-miR159a-3p
chr12:355153-355173
GLYMA12G00740
-
A5BS
TAGAGATCTTTTCATTCCTAA
TTTGGATTGAAGGGAGCTCTA
miRferno
ATGH9B1 (ARABIDOPSIS THALIANA GLYCOSYL HYDROLASE 9B1); cellulase/ hydrolase, hydrolyzing O-glycosyl compounds
22
gma-miR1522
chr1:644268-644287
GLYMA01G00990
+
A3BS
GTTTCAGTTTTGGCAAGAAA
TTTATTGCTTAAAATGAAAT
miRferno
protein kinase family protein / WD-40 repeat family protein
23
gma-miR1533
chr1:646068-646086
GLYMA01G00990
+
A3BS
TTTTTAATATTTTAAATAT
ATAATAAAAATAATAATGA
miRferno
protein kinase family protein / WD-40 repeat family protein
24
gma-miR3522
chr16:1167406-1167424
GLYMA16G01590
+
A3BS
GCAGCTTATCATTTGGCTT
AGACCAAATGAGCAGCTGA
miRferno
phosphatidylinositol-4-phosphate 5-kinase family protein
25
gma-miR1530
chr4:48410253-48410273
GLYMA04G42720
-
A5BS
ATATTATGTTGTATGTTAAAA
TTTTCACATAAATTAAAATAT
miRferno
TAPX (THYLAKOIDAL ASCORBATE PEROXIDASE); L-ascorbate peroxidase
26
gma-miR1533
chr4:48410330-48410348
GLYMA04G42720
-
A5BS
CCAATTTTAATTTTAATAT
ATAATAAAAATAATAATGA
miRferno
TAPX (THYLAKOIDAL ASCORBATE PEROXIDASE); L-ascorbate peroxidase
27
gma-miR1533
chr11:7365804-7365822
GLYMA11G10240
-
A5BS
TTATTATTATGTTTATTAT
ATAATAAAAATAATAATGA
miRferno
ATEXLA2 (ARABIDOPSIS THALIANA EXPANSIN-LIKE A2)
28
gma-miR4994-3p
chr11:7365751-7365771
GLYMA11G10240
-
A5BS
TATATAAGGTCAAGGTTTTCA
TGATATCCTTGAGCTAATACA
miRferno
ATEXLA2 (ARABIDOPSIS THALIANA EXPANSIN-LIKE A2)
29
gma-miR9746i
chr16:48146-48169
GLYMA16G00240
+
A5BS
ATCTAATTAATTTTAAACTACTTT
AAAGTGTTTGAATTTCAATTAGAT
miRferno
RNA recognition motif (RRM)-containing protein
30
gma-miR9746h;gma-miR9746b;gma-miR9746c;gma-miR9746
chr16:48146-48169
GLYMA16G00240
+
A5BS
ATCTAATTAATTTTAAACTACTTT
AAAGTGTTTGAATCTCAATTAGAT
miRferno
RNA recognition motif (RRM)-containing protein
IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/18 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>