Search By Other

 Search
 for  
 In 
       ?

miRNA target sites locating at the circular mRNA AS regions of Glycine max

Total 528 records in 18 Pages. Current page: 1
1/18 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    gma-miR5043
    chr20:24557214-24557234
    GLYMA20G17500
    +
    A5BS
    TGGGATGCAGTGAAGGAGACA
    TGTCCCCTTCTCTGCACCACC
    miRferno
    ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
    2
    gma-miR4341
    chr20:24558221-24558244
    GLYMA20G17500
    +
    A5BS
    CCTTCAGGTTAAAATTCCAATACG
    TGTGTTGAAAGTTTAACATGACGG
    miRferno
    ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
    3
    gma-miR1511
    chr20:24556830-24556849
    GLYMA20G17500
    +
    A5BS
    TATGGTATCAGAGCTCGATC
    AACCAGGCTCTGATACCATG
    miRferno
    ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
    4
    gma-miR1535a
    chr20:24560071-24560089
    GLYMA20G17500
    +
    A5BS
    AGTCAGCACCTCAAATAAG
    CTTGTTTGTGGTGATGTCT
    miRferno
    ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
    5
    gma-miR396c;gma-miR396b-5p;gma-miR396k-5p
    chr20:24546104-24546124
    GLYMA20G17500
    +
    A3BS
    AACTTAAAGGAGGCTGTGGAT
    TTCCACAGCTTTCTTGAACTT
    miRferno
    ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
    6
    gma-miR1533
    chr20:24547319-24547337
    GLYMA20G17500
    +
    A3BS
    TGATTATCATCATTATTAT
    ATAATAAAAATAATAATGA
    miRferno
    ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
    7
    gma-miR5374-3p
    chr20:24547589-24547609
    GLYMA20G17500
    +
    A3BS
    GTTTGTGATCAGATATTTGAA
    TTCAAATGTCAGATTATAAAA
    miRferno
    ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
    8
    gma-miR396h
    chr20:24546104-24546123
    GLYMA20G17500
    +
    A3BS
    AACTTAAAGGAGGCTGTGGA
    TCCACAGCTTTCTTGAACTG
    miRferno
    ATEXO70A1 (exocyst subunit EXO70 family protein A1); protein binding
    9
    gma-miR5039
    chr19:42942916-42942936
    GLYMA19G35410
    +
    A5BS
    GATGAAACAATTACAAAATGG
    CCCTTTTTTAATCGTTGCATG
    miRferno
    MYA2 (ARABIDOPSIS MYOSIN 2); GTP-dependent protein binding / Rab GTPase binding / motor
    10
    gma-miR9760
    chr17:15763034-15763054
    GLYMA17G18400
    +
    A3BS
    CAAGCAACTCTGCAGCATCCA
    TGGATGATGTAGTTTTGATTG
    miRferno
    SDN3 (SMALL RNA DEGRADING NUCLEASE 3); exonuclease/ nucleic acid binding
    11
    gma-miR5761b;gma-miR5761a
    chr15:4622076-4622096
    GLYMA15G06540
    -
    A5BS
    CAAATGCTAGACGACAGAAGA
    TTTTGTGTCGTGAAGCTTTTG
    miRferno
    magnesium transporter CorA-like protein-related
    12
    gma-miR1530
    chr3:36309060-36309080
    GLYMA03G28410
    +
    A3BS
    CTATATGAATTTATGAGAAAA
    TTTTCACATAAATTAAAATAT
    miRferno
    GLU1 (GLUTAMATE SYNTHASE 1); glutamate synthase (ferredoxin)
    13
    gma-miR1533
    chr3:36307650-36307668
    GLYMA03G28410
    +
    A3BS
    TTACTATTAGTTTTATCCT
    ATAATAAAAATAATAATGA
    miRferno
    GLU1 (GLUTAMATE SYNTHASE 1); glutamate synthase (ferredoxin)
    14
    gma-miR408d
    chr3:36308280-36308299
    GLYMA03G28410
    +
    A3BS
    GGGAGGCAATAGGAAGTGCA
    TGCACTGCCTCTTCCCTGGC
    miRferno
    GLU1 (GLUTAMATE SYNTHASE 1); glutamate synthase (ferredoxin)
    15
    gma-miR4396
    chr3:36310534-36310557
    GLYMA03G28410
    +
    A3BS
    GGCAGCATTGTCTCAGAAACCTCA
    TGTAGTTTCTAAGACGATGCTGAC
    miRferno
    GLU1 (GLUTAMATE SYNTHASE 1); glutamate synthase (ferredoxin)
    16
    gma-miR1521a
    chr16:4653761-4653780
    GLYMA16G05310
    +
    A3BS
    TAGTCATTTTCCATTAACCA
    CTGTTAATGGAAAATGTTGA
    miRferno
    zinc finger (C3HC4-type RING finger) family protein
    17
    gma-miR319p
    chr18:31739816-31739836
    GLYMA18G27710
    +
    A5BS
    GCAACACTCTTCAGGCCAAAA
    TTTTGGACTGAAGGGAGCTCC
    miRferno
    SHM1 (SERINE TRANSHYDROXYMETHYLTRANSFERASE 1); glycine hydroxymethyltransferase/ poly(U) binding
    18
    gma-miR1534
    chr12:5365554-5365573
    GLYMA12G07740
    +
    A5BS
    ATGACTGTTTACCTTGAAAA
    TATTTTGGGTAAATAGTCAT
    miRferno
    VHA-A1 (VACUOLAR PROTON ATPASE A 1); ATPase
    19
    gma-miR156g
    chr12:5365310-5365329
    GLYMA12G07740
    +
    A5BS
    TTGCCCTTTCTATTTTCTGT
    ACAGAAGATAGAGAGCACAG
    miRferno
    VHA-A1 (VACUOLAR PROTON ATPASE A 1); ATPase
    20
    gma-miR1512a-3p
    chr12:5365570-5365590
    GLYMA12G07740
    +
    A5BS
    AAAAACTGAAGTTCTTAAATT
    GCTTTAAGAATTTCAGTTATG
    miRferno
    VHA-A1 (VACUOLAR PROTON ATPASE A 1); ATPase
    21
    gma-miR159e-3p;gma-miR159a-3p
    chr12:355153-355173
    GLYMA12G00740
    -
    A5BS
    TAGAGATCTTTTCATTCCTAA
    TTTGGATTGAAGGGAGCTCTA
    miRferno
    ATGH9B1 (ARABIDOPSIS THALIANA GLYCOSYL HYDROLASE 9B1); cellulase/ hydrolase, hydrolyzing O-glycosyl compounds
    22
    gma-miR1522
    chr1:644268-644287
    GLYMA01G00990
    +
    A3BS
    GTTTCAGTTTTGGCAAGAAA
    TTTATTGCTTAAAATGAAAT
    miRferno
    protein kinase family protein / WD-40 repeat family protein
    23
    gma-miR1533
    chr1:646068-646086
    GLYMA01G00990
    +
    A3BS
    TTTTTAATATTTTAAATAT
    ATAATAAAAATAATAATGA
    miRferno
    protein kinase family protein / WD-40 repeat family protein
    24
    gma-miR3522
    chr16:1167406-1167424
    GLYMA16G01590
    +
    A3BS
    GCAGCTTATCATTTGGCTT
    AGACCAAATGAGCAGCTGA
    miRferno
    phosphatidylinositol-4-phosphate 5-kinase family protein
    25
    gma-miR1530
    chr4:48410253-48410273
    GLYMA04G42720
    -
    A5BS
    ATATTATGTTGTATGTTAAAA
    TTTTCACATAAATTAAAATAT
    miRferno
    TAPX (THYLAKOIDAL ASCORBATE PEROXIDASE); L-ascorbate peroxidase
    26
    gma-miR1533
    chr4:48410330-48410348
    GLYMA04G42720
    -
    A5BS
    CCAATTTTAATTTTAATAT
    ATAATAAAAATAATAATGA
    miRferno
    TAPX (THYLAKOIDAL ASCORBATE PEROXIDASE); L-ascorbate peroxidase
    27
    gma-miR1533
    chr11:7365804-7365822
    GLYMA11G10240
    -
    A5BS
    TTATTATTATGTTTATTAT
    ATAATAAAAATAATAATGA
    miRferno
    ATEXLA2 (ARABIDOPSIS THALIANA EXPANSIN-LIKE A2)
    28
    gma-miR4994-3p
    chr11:7365751-7365771
    GLYMA11G10240
    -
    A5BS
    TATATAAGGTCAAGGTTTTCA
    TGATATCCTTGAGCTAATACA
    miRferno
    ATEXLA2 (ARABIDOPSIS THALIANA EXPANSIN-LIKE A2)
    29
    gma-miR9746i
    chr16:48146-48169
    GLYMA16G00240
    +
    A5BS
    ATCTAATTAATTTTAAACTACTTT
    AAAGTGTTTGAATTTCAATTAGAT
    miRferno
    RNA recognition motif (RRM)-containing protein
    30
    gma-miR9746h;gma-miR9746b;gma-miR9746c;gma-miR9746
    chr16:48146-48169
    GLYMA16G00240
    +
    A5BS
    ATCTAATTAATTTTAAACTACTTT
    AAAGTGTTTGAATCTCAATTAGAT
    miRferno
    RNA recognition motif (RRM)-containing protein