Search By Other

 Search
 for  
 In 
       ?

miRNA target sites locating at the circular mRNA AS regions of Oryza sativa

Total 6839 records in 228 Pages. Current page: 1
1/228 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    osa-miR2093-3p
    chr02:6967137-6967156
    LOC_Os02g13110
    -
    A5BS
    ATGTATTAATTTGAAGTTTT
    ACATCTTCCAATTAATGCAT
    miRferno
    enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular,enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular
    2
    osa-miR2093-3p
    chr02:6967137-6967156
    LOC_Os02g13110
    -
    A5BS
    ATGTATTAATTTGAAGTTTT
    ACATCTTCCAATTAATGCAT
    miRferno
    enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular,enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular
    3
    osa-miR2093-3p
    chr02:6967137-6967156
    LOC_Os02g13110
    -
    A5BS
    ATGTATTAATTTGAAGTTTT
    ACATCTTCCAATTAATGCAT
    miRferno
    enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular,enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular
    4
    osa-miR5537
    chr02:6968458-6968479
    LOC_Os02g13110
    -
    A5BS
    ACAAATGAACCATACAATCGCT
    AATGTTTGTATGGATCGTTTGT
    miRferno
    enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular,enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular
    5
    osa-miR5537
    chr02:6968458-6968479
    LOC_Os02g13110
    -
    A5BS
    ACAAATGAACCATACAATCGCT
    AATGTTTGTATGGATCGTTTGT
    miRferno
    enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular,enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular
    6
    osa-miR2873a
    chr10:3836609-3836632
    LOC_Os10g07270
    -
    A5BS
    GTTACTAAATTTTTATATAAACTT
    AAGTTTGGACTTAAATTTGGTAAC
    miRferno
    cellular_component,protein metabolic process,catabolic process,cellular process,hydrolase activity
    7
    osa-miR437
    chr10:3836738-3836758
    LOC_Os10g07270
    -
    A5BS
    TAGTCAAACTTTTTTAAGTTA
    AAAGTTAGAGAAGTTTGACTT
    miRferno
    cellular_component,protein metabolic process,catabolic process,cellular process,hydrolase activity
    8
    osa-miR5831
    chr10:3836733-3836756
    LOC_Os10g07270
    -
    A5BS
    GTCAAACTTTTTTAAGTTAGACCA
    TAGTCAAACTTAGAATAGTTGGAC
    miRferno
    cellular_component,protein metabolic process,catabolic process,cellular process,hydrolase activity
    9
    osa-miR1435
    chr10:3836578-3836597
    LOC_Os10g07270
    -
    A5BS
    AAGAAGTTTGACTAGAAAAA
    TTTCTTAAGTCAAACTTTTT
    miRferno
    cellular_component,protein metabolic process,catabolic process,cellular process,hydrolase activity
    10
    osa-miR2095-3p
    chr09:415667-415686
    LOC_Os09g01590
    +
    A5BS
    AAATATATCATATATGGCAG
    CTTCCATTTATGATAAGTAT
    miRferno
    extracellular space,metabolic process,hydrolase activity
    11
    osa-miR5824
    chr09:415680-415703
    LOC_Os09g01590
    +
    A5BS
    ATGGCAGTGACTTCTCAACTGACT
    AGTCTGATAAGAAGTCAATGGCGT
    miRferno
    extracellular space,metabolic process,hydrolase activity
    12
    osa-miR1320-3p
    chr09:22605497-22605517
    LOC_Os09g39320
    -
    A5BS
    ATGGAACGAATTGATTTTGAA
    TGTAAAATTCATTCGTTCCAA
    miRferno
    metabolic process,cellular process,response to endogenous stimulus,signal transduction,post-embryonic development,multicellular organismal development,protein binding,kinase activity,protein modification process,biological_process,biosynthetic process,lipid metabolic process,membrane,endoplasmic reticulum
    13
    osa-miR1320-3p
    chr09:22605497-22605517
    LOC_Os09g39320
    -
    A5BS
    ATGGAACGAATTGATTTTGAA
    TGTAAAATTCATTCGTTCCAA
    miRferno
    metabolic process,cellular process,response to endogenous stimulus,signal transduction,post-embryonic development,multicellular organismal development,protein binding,kinase activity,protein modification process,biological_process,biosynthetic process,lipid metabolic process,membrane,endoplasmic reticulum
    14
    osa-miR1435
    chr09:22605584-22605603
    LOC_Os09g39320
    -
    A5BS
    AAAGAGTTTAAATTAATAGA
    TTTCTTAAGTCAAACTTTTT
    miRferno
    metabolic process,cellular process,response to endogenous stimulus,signal transduction,post-embryonic development,multicellular organismal development,protein binding,kinase activity,protein modification process,biological_process,biosynthetic process,lipid metabolic process,membrane,endoplasmic reticulum
    15
    osa-miR1435
    chr09:22605584-22605603
    LOC_Os09g39320
    -
    A5BS
    AAAGAGTTTAAATTAATAGA
    TTTCTTAAGTCAAACTTTTT
    miRferno
    metabolic process,cellular process,response to endogenous stimulus,signal transduction,post-embryonic development,multicellular organismal development,protein binding,kinase activity,protein modification process,biological_process,biosynthetic process,lipid metabolic process,membrane,endoplasmic reticulum
    16
    osa-miR5837.1
    chr07:16982704-16982724
    LOC_Os07g28940
    +
    A5BS
    TGCTGCCTGTGGTTGCAACAT
    ATGTTGGAATGACATGCAGCT
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    17
    osa-miR5837.1
    chr07:16982704-16982724
    LOC_Os07g28940
    +
    A5BS
    TGCTGCCTGTGGTTGCAACAT
    ATGTTGGAATGACATGCAGCT
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    18
    osa-miR5837.1
    chr07:16982704-16982724
    LOC_Os07g28940
    +
    A5BS
    TGCTGCCTGTGGTTGCAACAT
    ATGTTGGAATGACATGCAGCT
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    19
    osa-miR444c.2;osa-miR444b.2
    chr07:16977034-16977054
    LOC_Os07g28940
    +
    A5BS
    AAGGTAAAGAAAACAAATGCA
    TGCAGTTGTTGTCTCAAGCTT
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    20
    osa-miR444c.2;osa-miR444b.2
    chr07:16977034-16977054
    LOC_Os07g28940
    +
    A5BS
    AAGGTAAAGAAAACAAATGCA
    TGCAGTTGTTGTCTCAAGCTT
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    21
    osa-miR444c.2;osa-miR444b.2
    chr07:16977034-16977054
    LOC_Os07g28940
    +
    A5BS
    AAGGTAAAGAAAACAAATGCA
    TGCAGTTGTTGTCTCAAGCTT
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    22
    osa-miR160a-3p;osa-miR160b-3p
    chr07:16982016-16982036
    LOC_Os07g28940
    +
    A5BS
    CATTTTCAGCTCCTTGCACGG
    GCGTGCAAGGAGCCAAGCATG
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    23
    osa-miR160a-3p;osa-miR160b-3p
    chr07:16982016-16982036
    LOC_Os07g28940
    +
    A5BS
    CATTTTCAGCTCCTTGCACGG
    GCGTGCAAGGAGCCAAGCATG
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    24
    osa-miR160a-3p;osa-miR160b-3p
    chr07:16982016-16982036
    LOC_Os07g28940
    +
    A5BS
    CATTTTCAGCTCCTTGCACGG
    GCGTGCAAGGAGCCAAGCATG
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    25
    osa-miR1436
    chr07:16981211-16981231
    LOC_Os07g28940
    +
    A5BS
    ACTCCCTCCCTCCCATAGCAT
    ACATTATGGGACGGAGGGAGT
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    26
    osa-miR1436
    chr07:16981211-16981231
    LOC_Os07g28940
    +
    A5BS
    ACTCCCTCCCTCCCATAGCAT
    ACATTATGGGACGGAGGGAGT
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    27
    osa-miR415
    chr07:16980516-16980536
    LOC_Os07g28940
    +
    A5BS
    CCACTCTGCATCAGTTCTGTC
    AACAGAACAGAAGCAGAGCAG
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    28
    osa-miR415
    chr07:16980516-16980536
    LOC_Os07g28940
    +
    A5BS
    CCACTCTGCATCAGTTCTGTC
    AACAGAACAGAAGCAGAGCAG
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    29
    osa-miR2875
    chr07:16978383-16978406
    LOC_Os07g28940
    +
    A5BS
    TATAAACTTAATGTGATTGTGAAG
    ATTTACAGTCATATACAGTTTATA
    miRferno
    transport,cellular process,protein binding,Golgi apparatus
    30
    osa-miR2875
    chr07:16978383-16978406
    LOC_Os07g28940
    +
    A5BS
    TATAAACTTAATGTGATTGTGAAG
    ATTTACAGTCATATACAGTTTATA
    miRferno
    transport,cellular process,protein binding,Golgi apparatus