Search By Other

 Search
 for  
 In 
       ?

miRNA target sites locating at the circular mRNA AS regions of Oryza sativa

Total 6839 records in 228 Pages. Current page: 1
1/228 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
osa-miR2093-3p
chr02:6967137-6967156
LOC_Os02g13110
-
A5BS
ATGTATTAATTTGAAGTTTT
ACATCTTCCAATTAATGCAT
miRferno
enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular,enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular
2
osa-miR2093-3p
chr02:6967137-6967156
LOC_Os02g13110
-
A5BS
ATGTATTAATTTGAAGTTTT
ACATCTTCCAATTAATGCAT
miRferno
enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular,enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular
3
osa-miR2093-3p
chr02:6967137-6967156
LOC_Os02g13110
-
A5BS
ATGTATTAATTTGAAGTTTT
ACATCTTCCAATTAATGCAT
miRferno
enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular,enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular
4
osa-miR5537
chr02:6968458-6968479
LOC_Os02g13110
-
A5BS
ACAAATGAACCATACAATCGCT
AATGTTTGTATGGATCGTTTGT
miRferno
enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular,enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular
5
osa-miR5537
chr02:6968458-6968479
LOC_Os02g13110
-
A5BS
ACAAATGAACCATACAATCGCT
AATGTTTGTATGGATCGTTTGT
miRferno
enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular,enzyme regulator activity,nucleotide binding,cytosol,protein modification process,metabolic process,intracellular
6
osa-miR2873a
chr10:3836609-3836632
LOC_Os10g07270
-
A5BS
GTTACTAAATTTTTATATAAACTT
AAGTTTGGACTTAAATTTGGTAAC
miRferno
cellular_component,protein metabolic process,catabolic process,cellular process,hydrolase activity
7
osa-miR437
chr10:3836738-3836758
LOC_Os10g07270
-
A5BS
TAGTCAAACTTTTTTAAGTTA
AAAGTTAGAGAAGTTTGACTT
miRferno
cellular_component,protein metabolic process,catabolic process,cellular process,hydrolase activity
8
osa-miR5831
chr10:3836733-3836756
LOC_Os10g07270
-
A5BS
GTCAAACTTTTTTAAGTTAGACCA
TAGTCAAACTTAGAATAGTTGGAC
miRferno
cellular_component,protein metabolic process,catabolic process,cellular process,hydrolase activity
9
osa-miR1435
chr10:3836578-3836597
LOC_Os10g07270
-
A5BS
AAGAAGTTTGACTAGAAAAA
TTTCTTAAGTCAAACTTTTT
miRferno
cellular_component,protein metabolic process,catabolic process,cellular process,hydrolase activity
10
osa-miR2095-3p
chr09:415667-415686
LOC_Os09g01590
+
A5BS
AAATATATCATATATGGCAG
CTTCCATTTATGATAAGTAT
miRferno
extracellular space,metabolic process,hydrolase activity
11
osa-miR5824
chr09:415680-415703
LOC_Os09g01590
+
A5BS
ATGGCAGTGACTTCTCAACTGACT
AGTCTGATAAGAAGTCAATGGCGT
miRferno
extracellular space,metabolic process,hydrolase activity
12
osa-miR1320-3p
chr09:22605497-22605517
LOC_Os09g39320
-
A5BS
ATGGAACGAATTGATTTTGAA
TGTAAAATTCATTCGTTCCAA
miRferno
metabolic process,cellular process,response to endogenous stimulus,signal transduction,post-embryonic development,multicellular organismal development,protein binding,kinase activity,protein modification process,biological_process,biosynthetic process,lipid metabolic process,membrane,endoplasmic reticulum
13
osa-miR1320-3p
chr09:22605497-22605517
LOC_Os09g39320
-
A5BS
ATGGAACGAATTGATTTTGAA
TGTAAAATTCATTCGTTCCAA
miRferno
metabolic process,cellular process,response to endogenous stimulus,signal transduction,post-embryonic development,multicellular organismal development,protein binding,kinase activity,protein modification process,biological_process,biosynthetic process,lipid metabolic process,membrane,endoplasmic reticulum
14
osa-miR1435
chr09:22605584-22605603
LOC_Os09g39320
-
A5BS
AAAGAGTTTAAATTAATAGA
TTTCTTAAGTCAAACTTTTT
miRferno
metabolic process,cellular process,response to endogenous stimulus,signal transduction,post-embryonic development,multicellular organismal development,protein binding,kinase activity,protein modification process,biological_process,biosynthetic process,lipid metabolic process,membrane,endoplasmic reticulum
15
osa-miR1435
chr09:22605584-22605603
LOC_Os09g39320
-
A5BS
AAAGAGTTTAAATTAATAGA
TTTCTTAAGTCAAACTTTTT
miRferno
metabolic process,cellular process,response to endogenous stimulus,signal transduction,post-embryonic development,multicellular organismal development,protein binding,kinase activity,protein modification process,biological_process,biosynthetic process,lipid metabolic process,membrane,endoplasmic reticulum
16
osa-miR5837.1
chr07:16982704-16982724
LOC_Os07g28940
+
A5BS
TGCTGCCTGTGGTTGCAACAT
ATGTTGGAATGACATGCAGCT
miRferno
transport,cellular process,protein binding,Golgi apparatus
17
osa-miR5837.1
chr07:16982704-16982724
LOC_Os07g28940
+
A5BS
TGCTGCCTGTGGTTGCAACAT
ATGTTGGAATGACATGCAGCT
miRferno
transport,cellular process,protein binding,Golgi apparatus
18
osa-miR5837.1
chr07:16982704-16982724
LOC_Os07g28940
+
A5BS
TGCTGCCTGTGGTTGCAACAT
ATGTTGGAATGACATGCAGCT
miRferno
transport,cellular process,protein binding,Golgi apparatus
19
osa-miR444c.2;osa-miR444b.2
chr07:16977034-16977054
LOC_Os07g28940
+
A5BS
AAGGTAAAGAAAACAAATGCA
TGCAGTTGTTGTCTCAAGCTT
miRferno
transport,cellular process,protein binding,Golgi apparatus
20
osa-miR444c.2;osa-miR444b.2
chr07:16977034-16977054
LOC_Os07g28940
+
A5BS
AAGGTAAAGAAAACAAATGCA
TGCAGTTGTTGTCTCAAGCTT
miRferno
transport,cellular process,protein binding,Golgi apparatus
21
osa-miR444c.2;osa-miR444b.2
chr07:16977034-16977054
LOC_Os07g28940
+
A5BS
AAGGTAAAGAAAACAAATGCA
TGCAGTTGTTGTCTCAAGCTT
miRferno
transport,cellular process,protein binding,Golgi apparatus
22
osa-miR160a-3p;osa-miR160b-3p
chr07:16982016-16982036
LOC_Os07g28940
+
A5BS
CATTTTCAGCTCCTTGCACGG
GCGTGCAAGGAGCCAAGCATG
miRferno
transport,cellular process,protein binding,Golgi apparatus
23
osa-miR160a-3p;osa-miR160b-3p
chr07:16982016-16982036
LOC_Os07g28940
+
A5BS
CATTTTCAGCTCCTTGCACGG
GCGTGCAAGGAGCCAAGCATG
miRferno
transport,cellular process,protein binding,Golgi apparatus
24
osa-miR160a-3p;osa-miR160b-3p
chr07:16982016-16982036
LOC_Os07g28940
+
A5BS
CATTTTCAGCTCCTTGCACGG
GCGTGCAAGGAGCCAAGCATG
miRferno
transport,cellular process,protein binding,Golgi apparatus
25
osa-miR1436
chr07:16981211-16981231
LOC_Os07g28940
+
A5BS
ACTCCCTCCCTCCCATAGCAT
ACATTATGGGACGGAGGGAGT
miRferno
transport,cellular process,protein binding,Golgi apparatus
26
osa-miR1436
chr07:16981211-16981231
LOC_Os07g28940
+
A5BS
ACTCCCTCCCTCCCATAGCAT
ACATTATGGGACGGAGGGAGT
miRferno
transport,cellular process,protein binding,Golgi apparatus
27
osa-miR415
chr07:16980516-16980536
LOC_Os07g28940
+
A5BS
CCACTCTGCATCAGTTCTGTC
AACAGAACAGAAGCAGAGCAG
miRferno
transport,cellular process,protein binding,Golgi apparatus
28
osa-miR415
chr07:16980516-16980536
LOC_Os07g28940
+
A5BS
CCACTCTGCATCAGTTCTGTC
AACAGAACAGAAGCAGAGCAG
miRferno
transport,cellular process,protein binding,Golgi apparatus
29
osa-miR2875
chr07:16978383-16978406
LOC_Os07g28940
+
A5BS
TATAAACTTAATGTGATTGTGAAG
ATTTACAGTCATATACAGTTTATA
miRferno
transport,cellular process,protein binding,Golgi apparatus
30
osa-miR2875
chr07:16978383-16978406
LOC_Os07g28940
+
A5BS
TATAAACTTAATGTGATTGTGAAG
ATTTACAGTCATATACAGTTTATA
miRferno
transport,cellular process,protein binding,Golgi apparatus
IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/228 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>