Search By Other

 Search
 for  
 In 
       ?

miRNA target sites locating at the circular mRNA AS regions of Solanum lycopersicum

Total 14 records in 1 Pages. Current page: 1
1/1 1

  • IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    sly-miR156e-3p
    ch01:90949614-90949634
    Solyc01g101100.2
    -
    A5BS
    TGGGACAGCTAAAGCGTAAGC
    GCTTACTCTCTATCTGTCACC
    miRferno
    Receptor-like protein kinase (Q9LYS5_ARATH)
    2
    sly-miR169e-5p
    ch01:91737580-91737601
    Solyc01g103050.2
    +
    A5BS
    AAACTCAATTAACCCTTGGCTA
    TAGCCAAGGATGACTTGCCTTT
    miRferno
    Auxin Response Factor 1 (manually curated)
    3
    sly-miR1916
    ch04:63839231-63839250
    Solyc04g079320.2
    +
    A3BS
    TTGATGTGTTTATGTGACAA
    ATTTCACTTAGACACCTCAA
    miRferno
    Uroporphyrinogen III synthase (B0FMS4_HORVU)
    4
    sly-miR394-5p
    ch06:41604783-41604802
    Solyc06g066320.2
    -
    A3BS
    GAAGGTCCAAAGAATGCCGA
    TTGGCATTCTGTCCACCTCC
    miRferno
    Transcription factor iws1 (B6K1U8_SCHJY)
    5
    sly-miR9472-5p
    ch09:1503317-1503337
    Solyc09g008020.2
    +
    A5BS
    TAATCAATACCTCTACTGTAA
    TTTCAGTAGACGTTGTGAATA
    miRferno
    Cysteine-type peptidase (B6T6Y3_MAIZE)
    6
    sly-miR5303
    ch04:50612791-50612811
    Solyc04g051490.2
    -
    A5BS
    GTTGCTCGGACTCTCCAAAAT
    TTTTTGAAGAGTTCGAGCAAC
    miRferno
    Essential meiotic endonuclease 1B (C5H8J1_ARATH)
    7
    sly-miR5303
    ch04:50612791-50612811
    Solyc04g051490.2
    -
    A5BS
    GTTGCTCGGACTCTCCAAAAT
    TTTTTGAAGAGTTCGAGCAAC
    miRferno
    Essential meiotic endonuclease 1B (C5H8J1_ARATH)
    8
    sly-miR5304
    ch04:50611978-50611998
    Solyc04g051490.2
    -
    A5BS
    GGAGTGAGTATGTTGCTTTCA
    TCAATGCTACATACTCATCCC
    miRferno
    Essential meiotic endonuclease 1B (C5H8J1_ARATH)
    9
    sly-miR5304
    ch04:50611978-50611998
    Solyc04g051490.2
    -
    A5BS
    GGAGTGAGTATGTTGCTTTCA
    TCAATGCTACATACTCATCCC
    miRferno
    Essential meiotic endonuclease 1B (C5H8J1_ARATH)
    10
    sly-miR482d-3p
    ch04:50619825-50619846
    Solyc04g051490.2
    -
    A3BS
    TTGGGATGGAGGGAATAGTACA
    TTTCCTATTCCACCCATGCCAA
    miRferno
    Essential meiotic endonuclease 1B (C5H8J1_ARATH)
    11
    sly-miR164b-3p
    ch10:26427685-26427705
    Solyc10g044450.1
    +
    A5BS
    ATTGGGGAAGGAAAACCCGTG
    CACGTGTTCTCCTTCTCCAAC
    miRferno
    Upf3 regulator of nonsense transcripts-like protein B (Q2F5U6_BOMMO)
    12
    sly-miR399
    ch10:61969874-61969894
    Solyc10g080770.1
    +
    A3BS
    AAGAGCAACTGACCTTGGGCA
    TGCCAAAGGAGAGTTGCCCTA
    miRferno
    NPR1-interactor protein 1 (manually curated)
    13
    sly-miR9469-5p
    ch10:61970368-61970388
    Solyc10g080770.1
    +
    A3BS
    GAACTGGGTCTTCCTATTTGG
    CCACATAAGAAGACCGAATTC
    miRferno
    NPR1-interactor protein 1 (manually curated)
    14
    sly-miR9476-3p
    ch10:61969454-61969474
    Solyc10g080770.1
    +
    A3BS
    AGACTAGTCCTGAATGTTCTT
    AAAAAGATGCAGGACTAGACC
    miRferno
    NPR1-interactor protein 1 (manually curated)