Search By Other

 Search
 for  
 In 
       ?

miRNA target sites locating at the circular mRNA AS regions of Solanum lycopersicum

Total 14 records in 1 Pages. Current page: 1
1/1 1

IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
sly-miR156e-3p
ch01:90949614-90949634
Solyc01g101100.2
-
A5BS
TGGGACAGCTAAAGCGTAAGC
GCTTACTCTCTATCTGTCACC
miRferno
Receptor-like protein kinase (Q9LYS5_ARATH)
2
sly-miR169e-5p
ch01:91737580-91737601
Solyc01g103050.2
+
A5BS
AAACTCAATTAACCCTTGGCTA
TAGCCAAGGATGACTTGCCTTT
miRferno
Auxin Response Factor 1 (manually curated)
3
sly-miR1916
ch04:63839231-63839250
Solyc04g079320.2
+
A3BS
TTGATGTGTTTATGTGACAA
ATTTCACTTAGACACCTCAA
miRferno
Uroporphyrinogen III synthase (B0FMS4_HORVU)
4
sly-miR394-5p
ch06:41604783-41604802
Solyc06g066320.2
-
A3BS
GAAGGTCCAAAGAATGCCGA
TTGGCATTCTGTCCACCTCC
miRferno
Transcription factor iws1 (B6K1U8_SCHJY)
5
sly-miR9472-5p
ch09:1503317-1503337
Solyc09g008020.2
+
A5BS
TAATCAATACCTCTACTGTAA
TTTCAGTAGACGTTGTGAATA
miRferno
Cysteine-type peptidase (B6T6Y3_MAIZE)
6
sly-miR5303
ch04:50612791-50612811
Solyc04g051490.2
-
A5BS
GTTGCTCGGACTCTCCAAAAT
TTTTTGAAGAGTTCGAGCAAC
miRferno
Essential meiotic endonuclease 1B (C5H8J1_ARATH)
7
sly-miR5303
ch04:50612791-50612811
Solyc04g051490.2
-
A5BS
GTTGCTCGGACTCTCCAAAAT
TTTTTGAAGAGTTCGAGCAAC
miRferno
Essential meiotic endonuclease 1B (C5H8J1_ARATH)
8
sly-miR5304
ch04:50611978-50611998
Solyc04g051490.2
-
A5BS
GGAGTGAGTATGTTGCTTTCA
TCAATGCTACATACTCATCCC
miRferno
Essential meiotic endonuclease 1B (C5H8J1_ARATH)
9
sly-miR5304
ch04:50611978-50611998
Solyc04g051490.2
-
A5BS
GGAGTGAGTATGTTGCTTTCA
TCAATGCTACATACTCATCCC
miRferno
Essential meiotic endonuclease 1B (C5H8J1_ARATH)
10
sly-miR482d-3p
ch04:50619825-50619846
Solyc04g051490.2
-
A3BS
TTGGGATGGAGGGAATAGTACA
TTTCCTATTCCACCCATGCCAA
miRferno
Essential meiotic endonuclease 1B (C5H8J1_ARATH)
11
sly-miR164b-3p
ch10:26427685-26427705
Solyc10g044450.1
+
A5BS
ATTGGGGAAGGAAAACCCGTG
CACGTGTTCTCCTTCTCCAAC
miRferno
Upf3 regulator of nonsense transcripts-like protein B (Q2F5U6_BOMMO)
12
sly-miR399
ch10:61969874-61969894
Solyc10g080770.1
+
A3BS
AAGAGCAACTGACCTTGGGCA
TGCCAAAGGAGAGTTGCCCTA
miRferno
NPR1-interactor protein 1 (manually curated)
13
sly-miR9469-5p
ch10:61970368-61970388
Solyc10g080770.1
+
A3BS
GAACTGGGTCTTCCTATTTGG
CCACATAAGAAGACCGAATTC
miRferno
NPR1-interactor protein 1 (manually curated)
14
sly-miR9476-3p
ch10:61969454-61969474
Solyc10g080770.1
+
A3BS
AGACTAGTCCTGAATGTTCTT
AAAAAGATGCAGGACTAGACC
miRferno
NPR1-interactor protein 1 (manually curated)
IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/1 1