Search By Other

 Search
 for  
 In 
       ?

miRNA target sites locating at the circular mRNA AS regions of Zea mays

Total 206 records in 7 Pages. Current page: 1
1/7 1 2 3 4 5 6 7 Next> Last>>

IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
zma-miR399b-5p
chr2:223192290-223192310
Zm00001d007139
+
A3BS
TATACCAGAGGGGTGCTGCCC
GTGCAGCTCTCCTCTGGCATG
miRferno
AAA-type ATPase family protein
2
zma-miR399b-5p
chr2:223192290-223192310
Zm00001d007139
+
A3BS
TATACCAGAGGGGTGCTGCCC
GTGCAGCTCTCCTCTGGCATG
miRferno
AAA-type ATPase family protein
3
zma-miR156k-3p
chr2:83764663-83764684
Zm00001d004118
+
A3BS
TCTGAGGGAGAGAGAAGGGAGC
GCTCGCTTCTCTTTCTGTCAGC
miRferno
Protein MICRORCHIDIA 7
4
zma-miR156a-3p
chr2:83764663-83764684
Zm00001d004118
+
A3BS
TCTGAGGGAGAGAGAAGGGAGC
GCTCACTTCTCTCTCTGTCAGT
miRferno
Protein MICRORCHIDIA 7
5
zma-miR444b;zma-miR444a
chr2:83761849-83761869
Zm00001d004118
+
A3BS
AAGCATGAGATTACTTCTGCA
TGCAGTTGTTGTCTCAAGCTT
miRferno
Protein MICRORCHIDIA 7
6
zma-miR396g-3p
chr2:83762925-83762945
Zm00001d004118
+
A3BS
TCTTGCAAAGCTTTGTTGCAG
GTTCAAGAAAGCTGTGGAAGA
miRferno
Protein MICRORCHIDIA 7
7
zma-miR2275b-5p
chr2:83765328-83765348
Zm00001d004118
+
A3BS
GGTTCAATCGGCTGTAACCCT
AGGATTAGAGGCAACTGAACC
miRferno
Protein MICRORCHIDIA 7
8
zma-miR166l-5p
chr2:83758990-83759009
Zm00001d004118
+
A3BS
TTTGGCACCAGCCTCCACTA
GAATGGAGGCTGGTCCAAGA
miRferno
Protein MICRORCHIDIA 7
9
zma-miR156d-3p;zma-miR156g-3p;zma-miR156f-3p
chr2:83764663-83764684
Zm00001d004118
+
A3BS
TCTGAGGGAGAGAGAAGGGAGC
GCTCACTTCTCTTTCTGTCAGC
miRferno
Protein MICRORCHIDIA 7
10
zma-miR482-5p
chr6:46162553-46162571
Zm00001d035762
-
A5BS
AAAACTCCTTTATCTCTCT
TGGGAGATGAAGGAGCCTT
miRferno
Charged multivesicular body protein 5%3B Putative SNF domain containing family protein
11
zma-miR167i-3p;zma-miR167h-3p
chr10:107657382-107657400
Zm00001d025174
-
A3BS
GTGCAGCTGCAACATCTAA
GATCATGTTGCAGCTTCAC
miRferno
S-adenosyl-L-methionine-dependent methyltransferases superfamily protein
12
zma-miR164c-3p;zma-miR164h-3p
chr10:107657513-107657533
Zm00001d025174
-
A3BS
GATGGAGATCAAGGTTCCATG
CATGTGCCCTTCTTCTCCATC
miRferno
S-adenosyl-L-methionine-dependent methyltransferases superfamily protein
13
zma-miR399b-3p
chr7:87383212-87383232
Zm00001d020036
+
A3BS
CAGGACAGCAGTCTTTTGACT
TGCCAAAGGAGAGCTGTCCTG
miRferno
Embryonic flower 2%3B VEF family protein
14
zma-miR171f-5p
chr7:87379588-87379608
Zm00001d020036
+
A3BS
GACGCGGCCAGGCCAACATCG
CGATGTTGGCATGGCTCAATC
miRferno
Embryonic flower 2%3B VEF family protein
15
zma-miR169q-3p
chr7:87382226-87382244
Zm00001d020036
+
A3BS
CTTCGCCAGACCGCCTACG
GGCAGGCCTTCTGGCTAAG
miRferno
Embryonic flower 2%3B VEF family protein
16
zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
chr7:87386731-87386748
Zm00001d020036
+
A3BS
CAAGCCCAGGAACATGCC
GGCAGTCTCCTTGGCTAG
miRferno
Embryonic flower 2%3B VEF family protein
17
zma-miR166c-5p
chr3:184562470-184562490
Zm00001d042938
+
A5BS
TCTGAAGCCAGAAAACATTCT
GGAATGTTGTCTGGCTCGAGG
miRferno
Serine/threonine-protein kinase AFC1
18
zma-miR166g-5p
chr3:184562470-184562490
Zm00001d042938
+
A5BS
TCTGAAGCCAGAAAACATTCT
GGAATGTTGTCTGGTTGGAGA
miRferno
Serine/threonine-protein kinase AFC1
19
zma-miR167a-3p
chr5:114038228-114038249
Zm00001d015729
+
A3BS
AATGCCGCTGTCATGCCTGTTT
GATCATGCATGACAGCCTCATT
miRferno
Peptidyl-prolyl cis-trans isomerase CYP95
20
zma-miR164f-5p
chr3:180804251-180804271
Zm00001d042809
-
A3BS
AGCTCGTGCTCTACTTCACCG
TGGAGAAGCAGGGCACGTGCT
miRferno
Auxin transporter-like protein 1
21
zma-miR159e-3p
chr5:53962230-53962250
Zm00001d014572
-
A3BS
TGGAGATCTCGCTAAACCAAT
ATTGGTTTGAAGGGAGCTCCA
miRferno
Probable 2-oxoglutarate-dependent dioxygenase DIN11
22
zma-miR159e-3p
chr5:53962230-53962250
Zm00001d014572
-
A3BS
TGGAGATCTCGCTAAACCAAT
ATTGGTTTGAAGGGAGCTCCA
miRferno
Probable 2-oxoglutarate-dependent dioxygenase DIN11
23
zma-miR159e-3p
chr5:53962230-53962250
Zm00001d014572
-
A3BS
TGGAGATCTCGCTAAACCAAT
ATTGGTTTGAAGGGAGCTCCA
miRferno
Probable 2-oxoglutarate-dependent dioxygenase DIN11
24
zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
chr5:53959989-53960006
Zm00001d014572
-
A3BS
CTAGTCAAATGGACTGCG
GGCAGTCTCCTTGGCTAG
miRferno
Probable 2-oxoglutarate-dependent dioxygenase DIN11
25
zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
chr10:88840301-88840318
Zm00001d024807
+
A5BS
ATAGCCAATGCCACTTCC
GGCAGTCTCCTTGGCTAG
miRferno
MAP kinase6
26
zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
chr10:88840301-88840318
Zm00001d024807
+
A5BS
ATAGCCAATGCCACTTCC
GGCAGTCTCCTTGGCTAG
miRferno
MAP kinase6
27
zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
chr10:88840301-88840318
Zm00001d024807
+
A5BS
ATAGCCAATGCCACTTCC
GGCAGTCTCCTTGGCTAG
miRferno
MAP kinase6
28
zma-miR166g-5p
chr10:88838491-88838511
Zm00001d024807
+
A5BS
TCTCAAACCAAAAAATATTCT
GGAATGTTGTCTGGTTGGAGA
miRferno
MAP kinase6
29
zma-miR166g-5p
chr10:88838491-88838511
Zm00001d024807
+
A5BS
TCTCAAACCAAAAAATATTCT
GGAATGTTGTCTGGTTGGAGA
miRferno
MAP kinase6
30
zma-miR166g-5p
chr10:88838491-88838511
Zm00001d024807
+
A5BS
TCTCAAACCAAAAAATATTCT
GGAATGTTGTCTGGTTGGAGA
miRferno
MAP kinase6
IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/7 1 2 3 4 5 6 7 Next> Last>>