Search By Other

 Search
 for  
 In 
       ?

miRNA target sites locating at the circular mRNA AS regions of Zea mays

Total 206 records in 7 Pages. Current page: 1
1/7 1 2 3 4 5 6 7 Next> Last>>

  • IDMiRnameGenomicSiteASRegionTarGeneCircIDStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    zma-miR399b-5p
    chr2:223192290-223192310
    Zm00001d007139
    +
    A3BS
    TATACCAGAGGGGTGCTGCCC
    GTGCAGCTCTCCTCTGGCATG
    miRferno
    AAA-type ATPase family protein
    2
    zma-miR399b-5p
    chr2:223192290-223192310
    Zm00001d007139
    +
    A3BS
    TATACCAGAGGGGTGCTGCCC
    GTGCAGCTCTCCTCTGGCATG
    miRferno
    AAA-type ATPase family protein
    3
    zma-miR156k-3p
    chr2:83764663-83764684
    Zm00001d004118
    +
    A3BS
    TCTGAGGGAGAGAGAAGGGAGC
    GCTCGCTTCTCTTTCTGTCAGC
    miRferno
    Protein MICRORCHIDIA 7
    4
    zma-miR156a-3p
    chr2:83764663-83764684
    Zm00001d004118
    +
    A3BS
    TCTGAGGGAGAGAGAAGGGAGC
    GCTCACTTCTCTCTCTGTCAGT
    miRferno
    Protein MICRORCHIDIA 7
    5
    zma-miR444b;zma-miR444a
    chr2:83761849-83761869
    Zm00001d004118
    +
    A3BS
    AAGCATGAGATTACTTCTGCA
    TGCAGTTGTTGTCTCAAGCTT
    miRferno
    Protein MICRORCHIDIA 7
    6
    zma-miR396g-3p
    chr2:83762925-83762945
    Zm00001d004118
    +
    A3BS
    TCTTGCAAAGCTTTGTTGCAG
    GTTCAAGAAAGCTGTGGAAGA
    miRferno
    Protein MICRORCHIDIA 7
    7
    zma-miR2275b-5p
    chr2:83765328-83765348
    Zm00001d004118
    +
    A3BS
    GGTTCAATCGGCTGTAACCCT
    AGGATTAGAGGCAACTGAACC
    miRferno
    Protein MICRORCHIDIA 7
    8
    zma-miR166l-5p
    chr2:83758990-83759009
    Zm00001d004118
    +
    A3BS
    TTTGGCACCAGCCTCCACTA
    GAATGGAGGCTGGTCCAAGA
    miRferno
    Protein MICRORCHIDIA 7
    9
    zma-miR156d-3p;zma-miR156g-3p;zma-miR156f-3p
    chr2:83764663-83764684
    Zm00001d004118
    +
    A3BS
    TCTGAGGGAGAGAGAAGGGAGC
    GCTCACTTCTCTTTCTGTCAGC
    miRferno
    Protein MICRORCHIDIA 7
    10
    zma-miR482-5p
    chr6:46162553-46162571
    Zm00001d035762
    -
    A5BS
    AAAACTCCTTTATCTCTCT
    TGGGAGATGAAGGAGCCTT
    miRferno
    Charged multivesicular body protein 5%3B Putative SNF domain containing family protein
    11
    zma-miR167i-3p;zma-miR167h-3p
    chr10:107657382-107657400
    Zm00001d025174
    -
    A3BS
    GTGCAGCTGCAACATCTAA
    GATCATGTTGCAGCTTCAC
    miRferno
    S-adenosyl-L-methionine-dependent methyltransferases superfamily protein
    12
    zma-miR164c-3p;zma-miR164h-3p
    chr10:107657513-107657533
    Zm00001d025174
    -
    A3BS
    GATGGAGATCAAGGTTCCATG
    CATGTGCCCTTCTTCTCCATC
    miRferno
    S-adenosyl-L-methionine-dependent methyltransferases superfamily protein
    13
    zma-miR399b-3p
    chr7:87383212-87383232
    Zm00001d020036
    +
    A3BS
    CAGGACAGCAGTCTTTTGACT
    TGCCAAAGGAGAGCTGTCCTG
    miRferno
    Embryonic flower 2%3B VEF family protein
    14
    zma-miR171f-5p
    chr7:87379588-87379608
    Zm00001d020036
    +
    A3BS
    GACGCGGCCAGGCCAACATCG
    CGATGTTGGCATGGCTCAATC
    miRferno
    Embryonic flower 2%3B VEF family protein
    15
    zma-miR169q-3p
    chr7:87382226-87382244
    Zm00001d020036
    +
    A3BS
    CTTCGCCAGACCGCCTACG
    GGCAGGCCTTCTGGCTAAG
    miRferno
    Embryonic flower 2%3B VEF family protein
    16
    zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
    chr7:87386731-87386748
    Zm00001d020036
    +
    A3BS
    CAAGCCCAGGAACATGCC
    GGCAGTCTCCTTGGCTAG
    miRferno
    Embryonic flower 2%3B VEF family protein
    17
    zma-miR166c-5p
    chr3:184562470-184562490
    Zm00001d042938
    +
    A5BS
    TCTGAAGCCAGAAAACATTCT
    GGAATGTTGTCTGGCTCGAGG
    miRferno
    Serine/threonine-protein kinase AFC1
    18
    zma-miR166g-5p
    chr3:184562470-184562490
    Zm00001d042938
    +
    A5BS
    TCTGAAGCCAGAAAACATTCT
    GGAATGTTGTCTGGTTGGAGA
    miRferno
    Serine/threonine-protein kinase AFC1
    19
    zma-miR167a-3p
    chr5:114038228-114038249
    Zm00001d015729
    +
    A3BS
    AATGCCGCTGTCATGCCTGTTT
    GATCATGCATGACAGCCTCATT
    miRferno
    Peptidyl-prolyl cis-trans isomerase CYP95
    20
    zma-miR164f-5p
    chr3:180804251-180804271
    Zm00001d042809
    -
    A3BS
    AGCTCGTGCTCTACTTCACCG
    TGGAGAAGCAGGGCACGTGCT
    miRferno
    Auxin transporter-like protein 1
    21
    zma-miR159e-3p
    chr5:53962230-53962250
    Zm00001d014572
    -
    A3BS
    TGGAGATCTCGCTAAACCAAT
    ATTGGTTTGAAGGGAGCTCCA
    miRferno
    Probable 2-oxoglutarate-dependent dioxygenase DIN11
    22
    zma-miR159e-3p
    chr5:53962230-53962250
    Zm00001d014572
    -
    A3BS
    TGGAGATCTCGCTAAACCAAT
    ATTGGTTTGAAGGGAGCTCCA
    miRferno
    Probable 2-oxoglutarate-dependent dioxygenase DIN11
    23
    zma-miR159e-3p
    chr5:53962230-53962250
    Zm00001d014572
    -
    A3BS
    TGGAGATCTCGCTAAACCAAT
    ATTGGTTTGAAGGGAGCTCCA
    miRferno
    Probable 2-oxoglutarate-dependent dioxygenase DIN11
    24
    zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
    chr5:53959989-53960006
    Zm00001d014572
    -
    A3BS
    CTAGTCAAATGGACTGCG
    GGCAGTCTCCTTGGCTAG
    miRferno
    Probable 2-oxoglutarate-dependent dioxygenase DIN11
    25
    zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
    chr10:88840301-88840318
    Zm00001d024807
    +
    A5BS
    ATAGCCAATGCCACTTCC
    GGCAGTCTCCTTGGCTAG
    miRferno
    MAP kinase6
    26
    zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
    chr10:88840301-88840318
    Zm00001d024807
    +
    A5BS
    ATAGCCAATGCCACTTCC
    GGCAGTCTCCTTGGCTAG
    miRferno
    MAP kinase6
    27
    zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
    chr10:88840301-88840318
    Zm00001d024807
    +
    A5BS
    ATAGCCAATGCCACTTCC
    GGCAGTCTCCTTGGCTAG
    miRferno
    MAP kinase6
    28
    zma-miR166g-5p
    chr10:88838491-88838511
    Zm00001d024807
    +
    A5BS
    TCTCAAACCAAAAAATATTCT
    GGAATGTTGTCTGGTTGGAGA
    miRferno
    MAP kinase6
    29
    zma-miR166g-5p
    chr10:88838491-88838511
    Zm00001d024807
    +
    A5BS
    TCTCAAACCAAAAAATATTCT
    GGAATGTTGTCTGGTTGGAGA
    miRferno
    MAP kinase6
    30
    zma-miR166g-5p
    chr10:88838491-88838511
    Zm00001d024807
    +
    A5BS
    TCTCAAACCAAAAAATATTCT
    GGAATGTTGTCTGGTTGGAGA
    miRferno
    MAP kinase6