Prediction of miRNA target sites locating at alternative splicing regions

Paste alternative splicing sequences with fasta format here:



Paste miRNA sequences with fasta format here, e.g:
>ptc-miR156g
UUGACAGAAGAUAGAGAGCAC


genomeFeature:    tarPred:    tarScore:    misMat:    wob: