Prediction of miRNA target sites locating at the linear mRNA AS regions of Arabidopsis(miRferno)

e.g:
>ath-miR156g
CGACAGAAGAGAGTGAGCAC


AlternativeSplicingtype:    genomeFeature:    tarPred:    tarScore:    misMat:    wob:   



Prediction of miRNA target sites locating at the circular mRNA AS regions of Arabidopsis(miRferno)

e.g:
>ath-miR156g
CGACAGAAGAGAGTGAGCAC


genomeFeature:    tarPred:    tarScore:    misMat:    wob: