Prediction of miRNA target sites locating at the linear mRNA AS regions of Solanum lycopersicum(miRferno)

e.g:
>sly-miR156e-5p
TGATAGAAGAGAGTGAGCAC


AlternativeSplicingtype:    genomeFeature:    tarPred:    tarScore:    misMat:    wob:   



Prediction of miRNA target sites locating at the circular mRNA AS regions of Solanum lycopersicum(miRferno)

e.g:
>sly-miR164b-3p
CACGTGTTCTCCTTCTCCAAC


genomeFeature:    tarPred:    tarScore:    misMat:    wob: