Search By Other

 Search
 for  
 In 
       ?

Arabidopsis miRNA Target Genome sites

Total 94757 records in 3159 Pages. Current page: 1
1/3159 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1
ath-miR414
5
chr03:2785476-2785496
-
TGACGATTATGTTGATGAGAA
ACTGCTACTACTACTTCTACT
miRferno
AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
2
ath-miR869.2
5
chr03:2786034-2786054
-
TGCAACTACCACAACACCAAA
CAGTTGATAGAGTTGTGGTCT
miRferno
AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
3
ath-miR5640
4.5
chr03:2786648-2786668
-
TTCAGGTAATTCTTTCTCTCA
ACTTAGATTAAGGAAGAGAGT
miRferno
AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
4
ath-miR5662
4.5
chr03:2786321-2786340
-
CATCTCCCATGGTCTCTTGG
GTAGAGGTTACCAGTGGAGA
miRferno
AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
5
ath-miR5655
5
chr03:2785978-2785998
-
CTAATTCATATGTGTCAACTC
GAGGAAGAATACACAGATGAA
miRferno
AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
6
ath-miR866-3p
3.5
chr03:2786999-2787018
-
TGCTTAAAGCCGGATTTTGT
AGAAGTTTCTGCCTAAAACA
miRferno
AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
7
ath-miR5643a;ath-miR5643b
3.5
chr03:2784306-2784326
-
GGAAGCACATCTTAAGAGCCT
CGTTGGTCTAGAATTTTCGGA
miRferno
AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
8
ath-miR5017-3p
5
chr05:25836743-25836763
+
GTTTCAATTAAATTTGTATAA
AAACGATAATTAAACCATATT
miRferno
AT5G64640|MUB3
9
ath-miR854a;ath-miR854b;ath-miR854c;ath-miR854d;at
4.5
chr05:25836961-25836981
+
CTCCTCATATCTCTCCTCATC
GAGGAGGAGGGATAGGAGTAG
miRferno
AT5G64640|MUB3
10
ath-miR5658
5.5
chr05:25836921-25836941
+
TGGCATCCTCATCATCATCGC
AAAGTAGTAGTAGTAGTAGTA
miRferno
AT5G64640|MUB3
11
ath-miR426
4.5
chr05:25838286-25838306
+
GATATGGACAAAGTTCCAAGA
GCATTCCTGTTTAAAGGTTTT
miRferno
AT5G64640|MUB3
12
ath-miR866-3p
2.5
chr05:25838811-25838830
+
TTTTCGAGGACGGTTTTTGT
AGAAGTTTCTGCCTAAAACA
miRferno
AT5G64640|MUB3
13
ath-miR844-3p
5
chr01:28576569-28576589
-
AACTAGAAAGTTGACTTTAAA
TTGATCATTCTACCGAATATT
miRferno
AT1G76150|ECH2|ATECH2|enoyl-CoA hydratase 2|T23E18
14
ath-miR5021
5.5
chr01:28576732-28576751
-
TTATTGGCTTCTTCTTCTAA
AAAAGAAGAAGAAGAAGAGT
miRferno
AT1G76150|ECH2|ATECH2|enoyl-CoA hydratase 2|T23E18
15
ath-miR8170-3p
4.5
chr01:28577332-28577352
-
AATTTGAAAATTTTTAAGGAA
TGTATCTTTTAGAAATTCGTT
miRferno
AT1G76150|ECH2|ATECH2|enoyl-CoA hydratase 2|T23E18
16
ath-miR837-5p
4.5
chr01:28577375-28577395
-
GTAAATGAAGAAGAAAATGAT
ACTTTGCTTGTTCTTTGACTA
miRferno
AT1G76150|ECH2|ATECH2|enoyl-CoA hydratase 2|T23E18
17
ath-miR8165
4.0
chr03:4683462-4683482
+
TTCTTCACTTTTGCCTCTGTT
AGGAAGTGTGAACGGAGGTAA
miRferno
AT3G14120|NUP107|MAG2
18
ath-miR390b-3p
4.0
chr03:4682747-4682766
+
GGAGTTAAGGATGCATAGCA
CCTTGAGTCCTACCTATCGC
miRferno
AT3G14120|NUP107|MAG2
19
ath-miR156h
4.5
chr03:4685149-4685168
+
TTTCTCTCTTTGTTCAGTCG
CACGAGAGAAAGAAGACAGT
miRferno
AT3G14120|NUP107|MAG2
20
ath-miR158a-3p
5.0
chr03:4678800-4678819
+
TGCTTTGTGTGTTTGTGGGA
ACGAAACAGATGTAAACCCT
miRferno
AT3G14120|NUP107|MAG2
21
ath-miR156j
3.5
chr03:14084168-14084187
-
CTCCTTTCTCTCTTCTTTCA
CACGAGAGAGAGAAGACAGT
miRferno
AT3G33528
22
ath-miR172a;ath-miR172b-3p
4.0
chr03:14083706-14083726
-
ATGTAGCATAAAAAAGATTTT
TACGTCGTAGTAGTTCTAAGA
miRferno
AT3G33528
23
ath-miR156h
4.5
chr03:14084168-14084187
-
CTCCTTTCTCTCTTCTTTCA
CACGAGAGAAAGAAGACAGT
miRferno
AT3G33528
24
ath-miR156i
2.5
chr03:14084168-14084187
-
CTCCTTTCTCTCTTCTTTCA
GACGAGAGAGAGAAGACAGT
miRferno
AT3G33528
25
ath-miR393a-3p
5
chr03:14082846-14082866
-
AAACCTAAGAGAAAGGATGAG
TTAGGTTTCTCTATCGTACTA
miRferno
AT3G33528
26
ath-miR157d
4.5
chr03:14084168-14084187
-
CTCCTTTCTCTCTTCTTTCA
CACGAGAGATAGAAGACAGT
miRferno
AT3G33528
27
ath-miR158a-5p
4.0
chr05:3273978-3273998
-
TTTTCAAATTTGGAGTCAAGG
AAAGGTTTTAACATCTGTTTC
miRferno
AT5G10420|F12B17
28
ath-miR8170-3p
4.5
chr05:3275622-3275642
-
TCATAGGAAATATAAAAGCAA
TGTATCTTTTAGAAATTCGTT
miRferno
AT5G10420|F12B17
29
ath-miR5024-5p
4.5
chr05:16613547-16613568
-
TGTTAAATATTGGTCTCGTCTT
ACAATATAGAACCGGAACAGTA
miRferno
AT5G41540|MBK23
30
ath-miR5025
5.5
chr05:16614508-16614528
-
TGTCTTGTACATATATCCAGG
ACAGTGAATGTATATATGTCA
miRferno
AT5G41540|MBK23
IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1/3159 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>