Search By Other

 Search
 for  
 In 
       ?

Arabidopsis miRNA Target Genome sites

Total 94757 records in 3159 Pages. Current page: 1
1/3159 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    ath-miR414
    5
    chr03:2785476-2785496
    -
    TGACGATTATGTTGATGAGAA
    ACTGCTACTACTACTTCTACT
    miRferno
    AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
    2
    ath-miR869.2
    5
    chr03:2786034-2786054
    -
    TGCAACTACCACAACACCAAA
    CAGTTGATAGAGTTGTGGTCT
    miRferno
    AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
    3
    ath-miR5640
    4.5
    chr03:2786648-2786668
    -
    TTCAGGTAATTCTTTCTCTCA
    ACTTAGATTAAGGAAGAGAGT
    miRferno
    AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
    4
    ath-miR5662
    4.5
    chr03:2786321-2786340
    -
    CATCTCCCATGGTCTCTTGG
    GTAGAGGTTACCAGTGGAGA
    miRferno
    AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
    5
    ath-miR5655
    5
    chr03:2785978-2785998
    -
    CTAATTCATATGTGTCAACTC
    GAGGAAGAATACACAGATGAA
    miRferno
    AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
    6
    ath-miR866-3p
    3.5
    chr03:2786999-2787018
    -
    TGCTTAAAGCCGGATTTTGT
    AGAAGTTTCTGCCTAAAACA
    miRferno
    AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
    7
    ath-miR5643a;ath-miR5643b
    3.5
    chr03:2784306-2784326
    -
    GGAAGCACATCTTAAGAGCCT
    CGTTGGTCTAGAATTTTCGGA
    miRferno
    AT3G09090|DEX1|DEFECTIVE IN EXINE FORMATION 1|MZB10
    8
    ath-miR5017-3p
    5
    chr05:25836743-25836763
    +
    GTTTCAATTAAATTTGTATAA
    AAACGATAATTAAACCATATT
    miRferno
    AT5G64640|MUB3
    9
    ath-miR854a;ath-miR854b;ath-miR854c;ath-miR854d;at
    4.5
    chr05:25836961-25836981
    +
    CTCCTCATATCTCTCCTCATC
    GAGGAGGAGGGATAGGAGTAG
    miRferno
    AT5G64640|MUB3
    10
    ath-miR5658
    5.5
    chr05:25836921-25836941
    +
    TGGCATCCTCATCATCATCGC
    AAAGTAGTAGTAGTAGTAGTA
    miRferno
    AT5G64640|MUB3
    11
    ath-miR426
    4.5
    chr05:25838286-25838306
    +
    GATATGGACAAAGTTCCAAGA
    GCATTCCTGTTTAAAGGTTTT
    miRferno
    AT5G64640|MUB3
    12
    ath-miR866-3p
    2.5
    chr05:25838811-25838830
    +
    TTTTCGAGGACGGTTTTTGT
    AGAAGTTTCTGCCTAAAACA
    miRferno
    AT5G64640|MUB3
    13
    ath-miR844-3p
    5
    chr01:28576569-28576589
    -
    AACTAGAAAGTTGACTTTAAA
    TTGATCATTCTACCGAATATT
    miRferno
    AT1G76150|ECH2|ATECH2|enoyl-CoA hydratase 2|T23E18
    14
    ath-miR5021
    5.5
    chr01:28576732-28576751
    -
    TTATTGGCTTCTTCTTCTAA
    AAAAGAAGAAGAAGAAGAGT
    miRferno
    AT1G76150|ECH2|ATECH2|enoyl-CoA hydratase 2|T23E18
    15
    ath-miR8170-3p
    4.5
    chr01:28577332-28577352
    -
    AATTTGAAAATTTTTAAGGAA
    TGTATCTTTTAGAAATTCGTT
    miRferno
    AT1G76150|ECH2|ATECH2|enoyl-CoA hydratase 2|T23E18
    16
    ath-miR837-5p
    4.5
    chr01:28577375-28577395
    -
    GTAAATGAAGAAGAAAATGAT
    ACTTTGCTTGTTCTTTGACTA
    miRferno
    AT1G76150|ECH2|ATECH2|enoyl-CoA hydratase 2|T23E18
    17
    ath-miR8165
    4.0
    chr03:4683462-4683482
    +
    TTCTTCACTTTTGCCTCTGTT
    AGGAAGTGTGAACGGAGGTAA
    miRferno
    AT3G14120|NUP107|MAG2
    18
    ath-miR390b-3p
    4.0
    chr03:4682747-4682766
    +
    GGAGTTAAGGATGCATAGCA
    CCTTGAGTCCTACCTATCGC
    miRferno
    AT3G14120|NUP107|MAG2
    19
    ath-miR156h
    4.5
    chr03:4685149-4685168
    +
    TTTCTCTCTTTGTTCAGTCG
    CACGAGAGAAAGAAGACAGT
    miRferno
    AT3G14120|NUP107|MAG2
    20
    ath-miR158a-3p
    5.0
    chr03:4678800-4678819
    +
    TGCTTTGTGTGTTTGTGGGA
    ACGAAACAGATGTAAACCCT
    miRferno
    AT3G14120|NUP107|MAG2
    21
    ath-miR156j
    3.5
    chr03:14084168-14084187
    -
    CTCCTTTCTCTCTTCTTTCA
    CACGAGAGAGAGAAGACAGT
    miRferno
    AT3G33528
    22
    ath-miR172a;ath-miR172b-3p
    4.0
    chr03:14083706-14083726
    -
    ATGTAGCATAAAAAAGATTTT
    TACGTCGTAGTAGTTCTAAGA
    miRferno
    AT3G33528
    23
    ath-miR156h
    4.5
    chr03:14084168-14084187
    -
    CTCCTTTCTCTCTTCTTTCA
    CACGAGAGAAAGAAGACAGT
    miRferno
    AT3G33528
    24
    ath-miR156i
    2.5
    chr03:14084168-14084187
    -
    CTCCTTTCTCTCTTCTTTCA
    GACGAGAGAGAGAAGACAGT
    miRferno
    AT3G33528
    25
    ath-miR393a-3p
    5
    chr03:14082846-14082866
    -
    AAACCTAAGAGAAAGGATGAG
    TTAGGTTTCTCTATCGTACTA
    miRferno
    AT3G33528
    26
    ath-miR157d
    4.5
    chr03:14084168-14084187
    -
    CTCCTTTCTCTCTTCTTTCA
    CACGAGAGATAGAAGACAGT
    miRferno
    AT3G33528
    27
    ath-miR158a-5p
    4.0
    chr05:3273978-3273998
    -
    TTTTCAAATTTGGAGTCAAGG
    AAAGGTTTTAACATCTGTTTC
    miRferno
    AT5G10420|F12B17
    28
    ath-miR8170-3p
    4.5
    chr05:3275622-3275642
    -
    TCATAGGAAATATAAAAGCAA
    TGTATCTTTTAGAAATTCGTT
    miRferno
    AT5G10420|F12B17
    29
    ath-miR5024-5p
    4.5
    chr05:16613547-16613568
    -
    TGTTAAATATTGGTCTCGTCTT
    ACAATATAGAACCGGAACAGTA
    miRferno
    AT5G41540|MBK23
    30
    ath-miR5025
    5.5
    chr05:16614508-16614528
    -
    TGTCTTGTACATATATCCAGG
    ACAGTGAATGTATATATGTCA
    miRferno
    AT5G41540|MBK23