Search By Other

 Search
 for  
 In 
       ?

Eucalyptus grandis miRNA Target Genome sites

Total 3942 records in 132 Pages. Current page: 1
1/132 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    egr-miR-1
    5
    Chr01:2743935-2743954
    -
    ACAAACTTCACATACTTGCA
    TGGAATGTTGTGAAGTATGT
    miRferno
    5\'-3\' exonuclease family protein
    2
    egr-miR-1
    3.5
    Chr01:2737856-2737875
    -
    ACATTCTTTACATCATTCTG
    TGGAATGTTGTGAAGTATGT
    miRferno
    5\'-3\' exonuclease family protein
    3
    egr-miR-2c-3p
    5
    Chr01:2743813-2743832
    -
    TTGACCTATATTGGCTTTGC
    TCACAGCCAATATTGATGAA
    miRferno
    5\'-3\' exonuclease family protein
    4
    egr-miR-4988
    5
    Chr01:2646241-2646259
    +
    GGACTGAAGCTTTAGAAGT
    ACCTATCACACTTCAGTCC
    miRferno
    plastid transcriptionally active 4
    5
    egr-miR-4988
    5
    Chr01:2646241-2646259
    +
    GGACTGAAGCTTTAGAAGT
    ACCTATCACACTTCAGTCC
    miRferno
    plastid transcriptionally active 4
    6
    egr-miR-277
    5
    Chr01:2461728-2461749
    -
    CACTGGCGAGAAAATTCTTTTA
    TAAATGCATTTTCTGGCCCGTA
    miRferno
    P-loop containing nucleoside triphosphate hydrolases superfamily protein
    7
    egr-miR-2c-3p
    4
    Chr01:1206053-1206072
    +
    TTGATCATTATTAGATGTGA
    TCACAGCCAATATTGATGAA
    miRferno
    2-isopropylmalate synthase 1
    8
    egr-miR-1
    5
    Chr01:1249108-1249127
    +
    CCATTCGTCTCAACAATCCA
    TGGAATGTTGTGAAGTATGT
    miRferno
    Radical SAM superfamily protein
    9
    egr-miR-1
    5
    Chr01:1249108-1249127
    +
    CCATTCGTCTCAACAATCCA
    TGGAATGTTGTGAAGTATGT
    miRferno
    Radical SAM superfamily protein
    10
    egr-miR-1
    4.5
    Chr01:1646857-1646876
    -
    AAATATTTATCAACATTACA
    TGGAATGTTGTGAAGTATGT
    miRferno
    cell division cycle protein 48-related / CDC48-related
    11
    egr-miR-1
    4.5
    Chr01:1646857-1646876
    -
    AAATATTTATCAACATTACA
    TGGAATGTTGTGAAGTATGT
    miRferno
    cell division cycle protein 48-related / CDC48-related
    12
    egr-miR-2c-3p
    5
    Chr01:1686139-1686158
    +
    GAAATCAAAATGGGCTGTGA
    TCACAGCCAATATTGATGAA
    miRferno
    protein kinase family protein
    13
    egr-miR-87-3p
    4.5
    Chr01:1681609-1681628
    +
    ACATCTGAAATTTTCTTCTC
    GTGAGCAAAGTTTCAGGTGT
    miRferno
    protein kinase family protein
    14
    egr-miR-2c-3p
    5
    Chr01:1686139-1686158
    +
    GAAATCAAAATGGGCTGTGA
    TCACAGCCAATATTGATGAA
    miRferno
    protein kinase family protein
    15
    egr-miR-87-3p
    4.5
    Chr01:1681609-1681628
    +
    ACATCTGAAATTTTCTTCTC
    GTGAGCAAAGTTTCAGGTGT
    miRferno
    protein kinase family protein
    16
    egr-miR-2c-3p
    5
    Chr01:1686139-1686158
    +
    GAAATCAAAATGGGCTGTGA
    TCACAGCCAATATTGATGAA
    miRferno
    protein kinase family protein
    17
    egr-miR-87-3p
    4.5
    Chr01:1681609-1681628
    +
    ACATCTGAAATTTTCTTCTC
    GTGAGCAAAGTTTCAGGTGT
    miRferno
    protein kinase family protein
    18
    egr-miR-4988
    5
    Chr01:1736812-1736830
    +
    TGTGTGAAGTTTGATAGCT
    ACCTATCACACTTCAGTCC
    miRferno
    Leucine-rich repeat protein kinase family protein
    19
    egr-miR-1
    4.0
    Chr01:7622373-7622392
    +
    CCATATTTAACCACGTTCCA
    TGGAATGTTGTGAAGTATGT
    miRferno
    ankyrin repeat family protein
    20
    egr-miR-2c-3p
    5
    Chr01:7621865-7621884
    +
    TTCAACAAAATTGGCTAGAA
    TCACAGCCAATATTGATGAA
    miRferno
    ankyrin repeat family protein
    21
    egr-miR-4988
    5
    Chr01:7623432-7623450
    +
    CGACTGAATTGGCATAAGT
    ACCTATCACACTTCAGTCC
    miRferno
    ankyrin repeat family protein
    22
    egr-miR-87-3p
    3.0
    Chr01:7619099-7619118
    +
    GCATCTGAAATTTTGGTCGC
    GTGAGCAAAGTTTCAGGTGT
    miRferno
    ankyrin repeat family protein
    23
    egr-miR-4988
    5.5
    Chr01:7884223-7884241
    -
    GGACTGAAGCCTGCGGGGT
    ACCTATCACACTTCAGTCC
    miRferno
    acyl-activating enzyme 7
    24
    egr-miR-4988
    5
    Chr01:518828-518846
    -
    TCACTGAAGTGAAATCGGT
    ACCTATCACACTTCAGTCC
    miRferno
    Tetratricopeptide repeat (TPR)-like superfamily protein
    25
    egr-miR-1
    4.5
    Chr01:993881-993900
    -
    AAATATTTATCAACATTACA
    TGGAATGTTGTGAAGTATGT
    miRferno
    cell division cycle protein 48-related / CDC48-related
    26
    egr-miR-2c-3p
    5
    Chr01:1040292-1040311
    +
    GAAATCAAAATGGGCTGTGA
    TCACAGCCAATATTGATGAA
    miRferno
    protein kinase family protein
    27
    egr-miR-87-3p
    4.5
    Chr01:1035791-1035810
    +
    ACATCTGAAATTTTCTTCTC
    GTGAGCAAAGTTTCAGGTGT
    miRferno
    protein kinase family protein
    28
    egr-miR-1
    4.5
    Chr01:4421684-4421703
    -
    ACAGGCTTCTCAACAGTCCA
    TGGAATGTTGTGAAGTATGT
    miRferno
    --NA--
    29
    egr-miR-124b-3p
    5.0
    Chr01:5700623-5700642
    -
    AGTAATCATCTTGTGCCTTA
    TAAGGCACGCGGTGAATACC
    miRferno
    Poly (ADP-ribose) glycohydrolase (PARG)
    30
    egr-miR-124b-3p
    5.0
    Chr01:5700623-5700642
    -
    AGTAATCATCTTGTGCCTTA
    TAAGGCACGCGGTGAATACC
    miRferno
    Poly (ADP-ribose) glycohydrolase (PARG)