Search By Other

 Search
 for  
 In 
       ?

Eucalyptus grandis miRNA Target Genome sites

Total 3942 records in 132 Pages. Current page: 1
1/132 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1
egr-miR-1
5
Chr01:2743935-2743954
-
ACAAACTTCACATACTTGCA
TGGAATGTTGTGAAGTATGT
miRferno
5\'-3\' exonuclease family protein
2
egr-miR-1
3.5
Chr01:2737856-2737875
-
ACATTCTTTACATCATTCTG
TGGAATGTTGTGAAGTATGT
miRferno
5\'-3\' exonuclease family protein
3
egr-miR-2c-3p
5
Chr01:2743813-2743832
-
TTGACCTATATTGGCTTTGC
TCACAGCCAATATTGATGAA
miRferno
5\'-3\' exonuclease family protein
4
egr-miR-4988
5
Chr01:2646241-2646259
+
GGACTGAAGCTTTAGAAGT
ACCTATCACACTTCAGTCC
miRferno
plastid transcriptionally active 4
5
egr-miR-4988
5
Chr01:2646241-2646259
+
GGACTGAAGCTTTAGAAGT
ACCTATCACACTTCAGTCC
miRferno
plastid transcriptionally active 4
6
egr-miR-277
5
Chr01:2461728-2461749
-
CACTGGCGAGAAAATTCTTTTA
TAAATGCATTTTCTGGCCCGTA
miRferno
P-loop containing nucleoside triphosphate hydrolases superfamily protein
7
egr-miR-2c-3p
4
Chr01:1206053-1206072
+
TTGATCATTATTAGATGTGA
TCACAGCCAATATTGATGAA
miRferno
2-isopropylmalate synthase 1
8
egr-miR-1
5
Chr01:1249108-1249127
+
CCATTCGTCTCAACAATCCA
TGGAATGTTGTGAAGTATGT
miRferno
Radical SAM superfamily protein
9
egr-miR-1
5
Chr01:1249108-1249127
+
CCATTCGTCTCAACAATCCA
TGGAATGTTGTGAAGTATGT
miRferno
Radical SAM superfamily protein
10
egr-miR-1
4.5
Chr01:1646857-1646876
-
AAATATTTATCAACATTACA
TGGAATGTTGTGAAGTATGT
miRferno
cell division cycle protein 48-related / CDC48-related
11
egr-miR-1
4.5
Chr01:1646857-1646876
-
AAATATTTATCAACATTACA
TGGAATGTTGTGAAGTATGT
miRferno
cell division cycle protein 48-related / CDC48-related
12
egr-miR-2c-3p
5
Chr01:1686139-1686158
+
GAAATCAAAATGGGCTGTGA
TCACAGCCAATATTGATGAA
miRferno
protein kinase family protein
13
egr-miR-87-3p
4.5
Chr01:1681609-1681628
+
ACATCTGAAATTTTCTTCTC
GTGAGCAAAGTTTCAGGTGT
miRferno
protein kinase family protein
14
egr-miR-2c-3p
5
Chr01:1686139-1686158
+
GAAATCAAAATGGGCTGTGA
TCACAGCCAATATTGATGAA
miRferno
protein kinase family protein
15
egr-miR-87-3p
4.5
Chr01:1681609-1681628
+
ACATCTGAAATTTTCTTCTC
GTGAGCAAAGTTTCAGGTGT
miRferno
protein kinase family protein
16
egr-miR-2c-3p
5
Chr01:1686139-1686158
+
GAAATCAAAATGGGCTGTGA
TCACAGCCAATATTGATGAA
miRferno
protein kinase family protein
17
egr-miR-87-3p
4.5
Chr01:1681609-1681628
+
ACATCTGAAATTTTCTTCTC
GTGAGCAAAGTTTCAGGTGT
miRferno
protein kinase family protein
18
egr-miR-4988
5
Chr01:1736812-1736830
+
TGTGTGAAGTTTGATAGCT
ACCTATCACACTTCAGTCC
miRferno
Leucine-rich repeat protein kinase family protein
19
egr-miR-1
4.0
Chr01:7622373-7622392
+
CCATATTTAACCACGTTCCA
TGGAATGTTGTGAAGTATGT
miRferno
ankyrin repeat family protein
20
egr-miR-2c-3p
5
Chr01:7621865-7621884
+
TTCAACAAAATTGGCTAGAA
TCACAGCCAATATTGATGAA
miRferno
ankyrin repeat family protein
21
egr-miR-4988
5
Chr01:7623432-7623450
+
CGACTGAATTGGCATAAGT
ACCTATCACACTTCAGTCC
miRferno
ankyrin repeat family protein
22
egr-miR-87-3p
3.0
Chr01:7619099-7619118
+
GCATCTGAAATTTTGGTCGC
GTGAGCAAAGTTTCAGGTGT
miRferno
ankyrin repeat family protein
23
egr-miR-4988
5.5
Chr01:7884223-7884241
-
GGACTGAAGCCTGCGGGGT
ACCTATCACACTTCAGTCC
miRferno
acyl-activating enzyme 7
24
egr-miR-4988
5
Chr01:518828-518846
-
TCACTGAAGTGAAATCGGT
ACCTATCACACTTCAGTCC
miRferno
Tetratricopeptide repeat (TPR)-like superfamily protein
25
egr-miR-1
4.5
Chr01:993881-993900
-
AAATATTTATCAACATTACA
TGGAATGTTGTGAAGTATGT
miRferno
cell division cycle protein 48-related / CDC48-related
26
egr-miR-2c-3p
5
Chr01:1040292-1040311
+
GAAATCAAAATGGGCTGTGA
TCACAGCCAATATTGATGAA
miRferno
protein kinase family protein
27
egr-miR-87-3p
4.5
Chr01:1035791-1035810
+
ACATCTGAAATTTTCTTCTC
GTGAGCAAAGTTTCAGGTGT
miRferno
protein kinase family protein
28
egr-miR-1
4.5
Chr01:4421684-4421703
-
ACAGGCTTCTCAACAGTCCA
TGGAATGTTGTGAAGTATGT
miRferno
--NA--
29
egr-miR-124b-3p
5.0
Chr01:5700623-5700642
-
AGTAATCATCTTGTGCCTTA
TAAGGCACGCGGTGAATACC
miRferno
Poly (ADP-ribose) glycohydrolase (PARG)
30
egr-miR-124b-3p
5.0
Chr01:5700623-5700642
-
AGTAATCATCTTGTGCCTTA
TAAGGCACGCGGTGAATACC
miRferno
Poly (ADP-ribose) glycohydrolase (PARG)
IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1/132 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>