Search By Other

 Search
 for  
 In 
       ?

Glycine max miRNA Target Genome sites

Total 377884 records in 12597 Pages. Current page: 1
1/12597 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    gma-miR5038a;gma-miR5038b
    5.0
    chr7:4760547-4760567
    -
    TGCAGGGTGGTCAAATTCTCA
    ACCTGTCTCCGGTTTAAGAGT
    miRferno
    ARF9 (AUXIN RESPONSE FACTOR 9); transcription factor
    2
    gma-miR396j
    5
    chr7:4760253-4760273
    -
    TTGTCCTAAGCTATCTTCATT
    AAAAGGTGTCGATAGAACTTA
    miRferno
    ARF9 (AUXIN RESPONSE FACTOR 9); transcription factor
    3
    gma-miR156b
    4
    chr3:699443-699463
    +
    TCTTCTCTCTCTCTTCTCTCT
    ACACGAGAGAGAGAAGACAGT
    miRferno
    myb family transcription factor (MYB117)
    4
    gma-miR171i-5p
    4.0
    chr2:49701889-49701908
    +
    TTTGAGCGTTAGTTACTTGT
    AAACTCGTAACGAAAGAATA
    miRferno
    60S ribosomal protein L18A (RPL18aB)
    5
    gma-miR5368
    4
    chr4:14914057-14914075
    -
    TGTCTCCCTGTGACCTTCC
    ACAGATGGACTCTGACAGG
    miRferno
    unknown protein
    6
    gma-miR5777
    4.0
    chr4:14911009-14911030
    -
    GTGCACCCAGCATTATTGCTGA
    CACGTAGGTTGTAATAACGATC
    miRferno
    unknown protein
    7
    gma-miR167e;gma-miR167f
    4.5
    chr5:31872722-31872742
    -
    AAAATCATTTTGGCAGTTTTA
    TTCTAGTACGACCGTCGAAGT
    miRferno
    SAD1 (SUPERSENSITIVE TO ABA AND DROUGHT 1); RNA binding
    8
    gma-miR9738
    5.0
    chr20:35509277-35509298
    -
    GTGGATTCCACATTATTTTTCA
    CTTCTCAGGTGTAGTACAAAGT
    miRferno
    MATE efflux family protein
    9
    gma-miR395j;gma-miR395k;gma-miR395i;gma-miR395l;gm
    5
    chr8:6317029-6317049
    -
    TCTTTCCCCCACAAACTTCAT
    CTCAAGGGGGTTTGTGAAGTA
    miRferno
    PF04481
    10
    gma-miR1512a-5p
    3.5
    chr8:6317900-6317921
    -
    ATATTTTAAAAATATTTGGTTA
    TATGAAATTCTTAAAAGTCAAT
    miRferno
    PF04481
    11
    gma-miR1520d
    3.5
    chr12:3174128-3174149
    +
    TTGTCACGTATGATGTTTTGTT
    AACAGTGCACAGTACAAGACTA
    miRferno
    catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds
    12
    gma-miR4415a-5p
    4.0
    chr12:3171575-3171595
    +
    TATTTATTGTCATCAAAATTT
    GTAACTAAGAGTAGTGTTGAA
    miRferno
    catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds
    13
    gma-miR1536
    4.5
    chr12:3170083-3170103
    +
    TTTTCACATTTTTCTTTGCTT
    ATTTGTGTAAACAGAGACGAA
    miRferno
    catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds
    14
    gma-miR171i-5p
    5
    chr18:5972916-5972935
    +
    TTTGAACAGTGCTTTCCAAA
    AAACTCGTAACGAAAGAATA
    miRferno
    THIC (ThiaminC); ADP-ribose pyrophosphohydrolase/ catalytic/ iron-sulfur cluster binding
    15
    gma-miR9724
    5.0
    chr18:5978841-5978862
    +
    TGCAATTTTGATTCTATCTTTA
    AAGATAAAACTGTGATAGAGAT
    miRferno
    THIC (ThiaminC); ADP-ribose pyrophosphohydrolase/ catalytic/ iron-sulfur cluster binding
    16
    gma-miR9755
    4.5
    chr18:5971851-5971871
    +
    AGATGGAAAAATCCTGACTCA
    TCTACTTTTCAAGGACCTAGT
    miRferno
    THIC (ThiaminC); ADP-ribose pyrophosphohydrolase/ catalytic/ iron-sulfur cluster binding
    17
    gma-miR5371-3p
    4.5
    chr8:39444131-39444151
    +
    TGAAGACATTGGTCACTCAGA
    AGATCTTTAATCAGTGACTCT
    miRferno
    KUP6; potassium ion transmembrane transporter
    18
    gma-miR5777
    5.5
    chr8:39448230-39448251
    +
    GTTTATCCATCATTAATCCTAG
    CACGTAGGTTGTAATAACGATC
    miRferno
    KUP6; potassium ion transmembrane transporter
    19
    gma-miR4348b
    4.5
    chr3:35317707-35317727
    -
    TTAAGAGTCAAATGAAAACGA
    GATTATCAGTTTAAGTTTTCT
    miRferno
    GTB1; RNA binding / hydrolase, acting on ester bonds / transcription elongation regulator
    20
    gma-miR396g
    5.5
    chr3:35324518-35324538
    -
    GCTCTACAAGAAGCTCAAGAA
    CTACGTATTCTTCAAGTTCTT
    miRferno
    GTB1; RNA binding / hydrolase, acting on ester bonds / transcription elongation regulator
    21
    gma-miR396g
    4.5
    chr3:35324691-35324711
    -
    GATGAAGAAGAAGTTGATGAG
    CTACGTATTCTTCAAGTTCTT
    miRferno
    GTB1; RNA binding / hydrolase, acting on ester bonds / transcription elongation regulator
    22
    gma-miR4352b
    6.5
    chr16:22604077-22604100
    -
    CCCTCTTATGATGCCTACCTATTA
    GGCAGAATCTTACAGATGTAAAAT
    miRferno
    metalloendopeptidase
    23
    gma-miR9766
    4.0
    chr16:22604801-22604821
    -
    ACTTCATTCCTTCTTTACAAA
    CAAAGTAAGGAAGGGAAGTTT
    miRferno
    metalloendopeptidase
    24
    gma-miR5380c
    4.5
    chr1:26544085-26544105
    -
    TTCTCCATCTTCCCCTTTCTT
    GAGAAGTAGAAGTGGTAAGTA
    miRferno
    aspartyl protease family protein
    25
    gma-miR166i-5p
    5
    chr1:26543894-26543913
    -
    CTCTCCCCAAACGACACTCC
    GAGCTTGGTCTGCTGTAAGG
    miRferno
    aspartyl protease family protein
    26
    gma-miR4414-3p
    5.0
    chr16:18559987-18560006
    -
    ATTGCTCCTGCATCGTTAGA
    CGTCGAGGGCGTAGCAACCT
    miRferno
    XBCP3 (xylem bark cysteine peptidase 3); cysteine-type endopeptidase/ cysteine-type peptidase
    27
    gma-miR319o;gma-miR319d
    4.5
    chr16:18560128-18560149
    -
    AAAGAAGCTCCCCTTCTGGCTA
    CTTCCTCGAGGGGAAGTCAGGT
    miRferno
    XBCP3 (xylem bark cysteine peptidase 3); cysteine-type endopeptidase/ cysteine-type peptidase
    28
    gma-miR5034
    4
    chr9:21086739-21086760
    -
    TGAGAATATATAAAAGGGTAGC
    ACTCTGATAGACTTTCCCATGG
    miRferno
    emsy N terminus domain-containing protein / ENT domain-containing protein
    29
    gma-miR4363
    4.0
    chr9:21084398-21084419
    -
    AAAATAAGCCTTTTTGTAATTG
    GATTATTCGGAAGACCATTAGC
    miRferno
    emsy N terminus domain-containing protein / ENT domain-containing protein
    30
    gma-miR9760
    4.5
    chr9:21087118-21087138
    -
    CAAACAAAAAAAAATTATCCA
    GTTAGTTTTGATGTAGTAGGT
    miRferno
    emsy N terminus domain-containing protein / ENT domain-containing protein