Search By Other

 Search
 for  
 In 
       ?

Glycine max miRNA Target Genome sites

Total 377884 records in 12597 Pages. Current page: 1
1/12597 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1
gma-miR5038a;gma-miR5038b
5.0
chr7:4760547-4760567
-
TGCAGGGTGGTCAAATTCTCA
ACCTGTCTCCGGTTTAAGAGT
miRferno
ARF9 (AUXIN RESPONSE FACTOR 9); transcription factor
2
gma-miR396j
5
chr7:4760253-4760273
-
TTGTCCTAAGCTATCTTCATT
AAAAGGTGTCGATAGAACTTA
miRferno
ARF9 (AUXIN RESPONSE FACTOR 9); transcription factor
3
gma-miR156b
4
chr3:699443-699463
+
TCTTCTCTCTCTCTTCTCTCT
ACACGAGAGAGAGAAGACAGT
miRferno
myb family transcription factor (MYB117)
4
gma-miR171i-5p
4.0
chr2:49701889-49701908
+
TTTGAGCGTTAGTTACTTGT
AAACTCGTAACGAAAGAATA
miRferno
60S ribosomal protein L18A (RPL18aB)
5
gma-miR5368
4
chr4:14914057-14914075
-
TGTCTCCCTGTGACCTTCC
ACAGATGGACTCTGACAGG
miRferno
unknown protein
6
gma-miR5777
4.0
chr4:14911009-14911030
-
GTGCACCCAGCATTATTGCTGA
CACGTAGGTTGTAATAACGATC
miRferno
unknown protein
7
gma-miR167e;gma-miR167f
4.5
chr5:31872722-31872742
-
AAAATCATTTTGGCAGTTTTA
TTCTAGTACGACCGTCGAAGT
miRferno
SAD1 (SUPERSENSITIVE TO ABA AND DROUGHT 1); RNA binding
8
gma-miR9738
5.0
chr20:35509277-35509298
-
GTGGATTCCACATTATTTTTCA
CTTCTCAGGTGTAGTACAAAGT
miRferno
MATE efflux family protein
9
gma-miR395j;gma-miR395k;gma-miR395i;gma-miR395l;gm
5
chr8:6317029-6317049
-
TCTTTCCCCCACAAACTTCAT
CTCAAGGGGGTTTGTGAAGTA
miRferno
PF04481
10
gma-miR1512a-5p
3.5
chr8:6317900-6317921
-
ATATTTTAAAAATATTTGGTTA
TATGAAATTCTTAAAAGTCAAT
miRferno
PF04481
11
gma-miR1520d
3.5
chr12:3174128-3174149
+
TTGTCACGTATGATGTTTTGTT
AACAGTGCACAGTACAAGACTA
miRferno
catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds
12
gma-miR4415a-5p
4.0
chr12:3171575-3171595
+
TATTTATTGTCATCAAAATTT
GTAACTAAGAGTAGTGTTGAA
miRferno
catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds
13
gma-miR1536
4.5
chr12:3170083-3170103
+
TTTTCACATTTTTCTTTGCTT
ATTTGTGTAAACAGAGACGAA
miRferno
catalytic/ cation binding / hydrolase, hydrolyzing O-glycosyl compounds
14
gma-miR171i-5p
5
chr18:5972916-5972935
+
TTTGAACAGTGCTTTCCAAA
AAACTCGTAACGAAAGAATA
miRferno
THIC (ThiaminC); ADP-ribose pyrophosphohydrolase/ catalytic/ iron-sulfur cluster binding
15
gma-miR9724
5.0
chr18:5978841-5978862
+
TGCAATTTTGATTCTATCTTTA
AAGATAAAACTGTGATAGAGAT
miRferno
THIC (ThiaminC); ADP-ribose pyrophosphohydrolase/ catalytic/ iron-sulfur cluster binding
16
gma-miR9755
4.5
chr18:5971851-5971871
+
AGATGGAAAAATCCTGACTCA
TCTACTTTTCAAGGACCTAGT
miRferno
THIC (ThiaminC); ADP-ribose pyrophosphohydrolase/ catalytic/ iron-sulfur cluster binding
17
gma-miR5371-3p
4.5
chr8:39444131-39444151
+
TGAAGACATTGGTCACTCAGA
AGATCTTTAATCAGTGACTCT
miRferno
KUP6; potassium ion transmembrane transporter
18
gma-miR5777
5.5
chr8:39448230-39448251
+
GTTTATCCATCATTAATCCTAG
CACGTAGGTTGTAATAACGATC
miRferno
KUP6; potassium ion transmembrane transporter
19
gma-miR4348b
4.5
chr3:35317707-35317727
-
TTAAGAGTCAAATGAAAACGA
GATTATCAGTTTAAGTTTTCT
miRferno
GTB1; RNA binding / hydrolase, acting on ester bonds / transcription elongation regulator
20
gma-miR396g
5.5
chr3:35324518-35324538
-
GCTCTACAAGAAGCTCAAGAA
CTACGTATTCTTCAAGTTCTT
miRferno
GTB1; RNA binding / hydrolase, acting on ester bonds / transcription elongation regulator
21
gma-miR396g
4.5
chr3:35324691-35324711
-
GATGAAGAAGAAGTTGATGAG
CTACGTATTCTTCAAGTTCTT
miRferno
GTB1; RNA binding / hydrolase, acting on ester bonds / transcription elongation regulator
22
gma-miR4352b
6.5
chr16:22604077-22604100
-
CCCTCTTATGATGCCTACCTATTA
GGCAGAATCTTACAGATGTAAAAT
miRferno
metalloendopeptidase
23
gma-miR9766
4.0
chr16:22604801-22604821
-
ACTTCATTCCTTCTTTACAAA
CAAAGTAAGGAAGGGAAGTTT
miRferno
metalloendopeptidase
24
gma-miR5380c
4.5
chr1:26544085-26544105
-
TTCTCCATCTTCCCCTTTCTT
GAGAAGTAGAAGTGGTAAGTA
miRferno
aspartyl protease family protein
25
gma-miR166i-5p
5
chr1:26543894-26543913
-
CTCTCCCCAAACGACACTCC
GAGCTTGGTCTGCTGTAAGG
miRferno
aspartyl protease family protein
26
gma-miR4414-3p
5.0
chr16:18559987-18560006
-
ATTGCTCCTGCATCGTTAGA
CGTCGAGGGCGTAGCAACCT
miRferno
XBCP3 (xylem bark cysteine peptidase 3); cysteine-type endopeptidase/ cysteine-type peptidase
27
gma-miR319o;gma-miR319d
4.5
chr16:18560128-18560149
-
AAAGAAGCTCCCCTTCTGGCTA
CTTCCTCGAGGGGAAGTCAGGT
miRferno
XBCP3 (xylem bark cysteine peptidase 3); cysteine-type endopeptidase/ cysteine-type peptidase
28
gma-miR5034
4
chr9:21086739-21086760
-
TGAGAATATATAAAAGGGTAGC
ACTCTGATAGACTTTCCCATGG
miRferno
emsy N terminus domain-containing protein / ENT domain-containing protein
29
gma-miR4363
4.0
chr9:21084398-21084419
-
AAAATAAGCCTTTTTGTAATTG
GATTATTCGGAAGACCATTAGC
miRferno
emsy N terminus domain-containing protein / ENT domain-containing protein
30
gma-miR9760
4.5
chr9:21087118-21087138
-
CAAACAAAAAAAAATTATCCA
GTTAGTTTTGATGTAGTAGGT
miRferno
emsy N terminus domain-containing protein / ENT domain-containing protein
IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1/12597 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>