Search By Other

 Search
 for  
 In 
       ?

Glycine max miRNA Target Genome sites

Total 377884 records in 12597 Pages. Current page: 10

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    gma-miR156r
    4.5
    chr20:34688340-34688360
    +
    AAGCTCTTTATCTTCTACCAT
    TACGAGAGATAGAAGACAGTC
    miRferno
    JAG (JAGGED); nucleic acid binding / transcription factor/ zinc ion binding
    2
    gma-miR9726
    5
    chr7:3495773-3495794
    -
    GAAGAAAAATATAAAACCTAAT
    CTTCTTTTTTTATTACGGATAT
    miRferno
    SEC22; transporter
    3
    gma-miR1514a-5p
    5.5
    chr6:42498098-42498118
    -
    AATGCCTCTTTGATAGTTGAA
    TTACGGATAAAATTTTTACTT
    miRferno
    cytochrome c biogenesis protein family
    4
    gma-miR5033
    5.0
    chr6:42496633-42496653
    -
    GTAGTTTTCTACTGTTCAGGC
    CATCAAAGGAAAACATGTCGG
    miRferno
    cytochrome c biogenesis protein family
    5
    gma-miR1508b
    4.5
    chr13:33947417-33947437
    +
    CAAATGTTCTTCCACTTTCTC
    GTTGACGATAAGGGGAAAGAT
    miRferno
    alpha 1,4-glycosyltransferase family protein / glycosyltransferase sugar-binding DXD motif-containing protein
    6
    gma-miR9722
    5.5
    chr13:33947720-33947740
    +
    GTTCTCTTCTTCCCTCAATTC
    AAGTAGAAGAAGGGAGATAAT
    miRferno
    alpha 1,4-glycosyltransferase family protein / glycosyltransferase sugar-binding DXD motif-containing protein
    7
    gma-miR171i-5p
    5.5
    chr6:5337132-5337151
    -
    TTTGACCAAATCTTTGTTAT
    AAACTCGTAACGAAAGAATA
    miRferno
    CESA1 (CELLULOSE SYNTHASE 1); cellulose synthase/ transferase, transferring glycosyl groups
    8
    gma-miR9722
    3.5
    chr6:5335455-5335475
    -
    ATAATCTTTTTCCCTTTGTTA
    AAGTAGAAGAAGGGAGATAAT
    miRferno
    CESA1 (CELLULOSE SYNTHASE 1); cellulose synthase/ transferase, transferring glycosyl groups
    9
    gma-miR5380c
    5.5
    chr4:4742253-4742273
    +
    CACTTCATCTGCTTCATGCAT
    GAGAAGTAGAAGTGGTAAGTA
    miRferno
    AHK5 (ARABIDOPSIS HISTIDINE KINASE 5); protein histidine kinase
    10
    gma-miR171i-5p
    5.0
    chr8:642812-642831
    +
    TTTGAGGGTTTCTTTTTAAT
    AAACTCGTAACGAAAGAATA
    miRferno
    ARF2 (AUXIN RESPONSE FACTOR 2); protein binding / transcription factor
    11
    gma-miR4996
    5.5
    chr8:642616-642635
    +
    GTGAGAATGGGGAACTTCGA
    CTCTTGTACCCCTCGAAGAT
    miRferno
    ARF2 (AUXIN RESPONSE FACTOR 2); protein binding / transcription factor
    12
    gma-miR1536
    5.0
    chr8:645632-645652
    +
    TAAACATGATTGTCTCTTATT
    ATTTGTGTAAACAGAGACGAA
    miRferno
    ARF2 (AUXIN RESPONSE FACTOR 2); protein binding / transcription factor
    13
    gma-miR4406
    6.5
    chr8:642927-642950
    +
    TACATGGAGTCTCTCAAAAACAAT
    ATGTGGCCAAGAGAGTCTTAGTTA
    miRferno
    ARF2 (AUXIN RESPONSE FACTOR 2); protein binding / transcription factor
    14
    gma-miR1514a-5p
    5
    chr8:645621-645641
    +
    AAGGGCGATTTTAAACATGAT
    TTACGGATAAAATTTTTACTT
    miRferno
    ARF2 (AUXIN RESPONSE FACTOR 2); protein binding / transcription factor
    15
    gma-miR171i-5p
    5
    chr19:49934394-49934413
    -
    TATGACCATTTATTTCTTTT
    AAACTCGTAACGAAAGAATA
    miRferno
    DMS3 (DEFECTIVE IN MERISTEM SILENCING 3)
    16
    gma-miR9726
    5
    chr6:2487744-2487765
    +
    CAATAACAAAATATTGCCAATA
    CTTCTTTTTTTATTACGGATAT
    miRferno
    glucose-6-phosphate isomerase, cytosolic (PGIC)
    17
    gma-miR9722
    4.5
    chr6:2489899-2489919
    +
    TTCTTCTTGCTGCCTCTATTG
    AAGTAGAAGAAGGGAGATAAT
    miRferno
    glucose-6-phosphate isomerase, cytosolic (PGIC)
    18
    gma-miR156e;gma-miR156d;gma-miR156c;gma-miR156m;gm
    4.5
    chr16:3345570-3345590
    -
    TTTCTTTCTTTCTTCTGTCAC
    CACGAGAGATAGAAGACAGTT
    miRferno
    UNE7 (unfertilized embryo sac 7); acetylglucosaminyltransferase/ transferase, transferring glycosyl groups
    19
    gma-miR9764
    4.5
    chr16:3343394-3343414
    -
    GAGAAAGTAAGGGGTCATACA
    CTCTTTCATTCTCACATAGGT
    miRferno
    UNE7 (unfertilized embryo sac 7); acetylglucosaminyltransferase/ transferase, transferring glycosyl groups
    20
    gma-miR156b
    3.0
    chr16:3345571-3345591
    -
    TTTTCTTTCTTTCTTCTGTCA
    ACACGAGAGAGAGAAGACAGT
    miRferno
    UNE7 (unfertilized embryo sac 7); acetylglucosaminyltransferase/ transferase, transferring glycosyl groups
    21
    gma-miR156r
    4.5
    chr16:3345570-3345590
    -
    TTTCTTTCTTTCTTCTGTCAC
    TACGAGAGATAGAAGACAGTC
    miRferno
    UNE7 (unfertilized embryo sac 7); acetylglucosaminyltransferase/ transferase, transferring glycosyl groups
    22
    gma-miR1507c-5p
    3.0
    chr16:11160083-11160103
    +
    TTTTCTCATCCCATACATCTA
    AAGAGAGTAGGGTTTGTGGAG
    miRferno
    MHK; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase
    23
    gma-miR5037b
    4.0
    chr16:11151691-11151710
    +
    CTACAAAGTCTTTGGGGCTT
    GATCCTTCGGAAACTCCCAA
    miRferno
    MHK; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase
    24
    gma-miR5559
    4.0
    chr16:11160887-11160907
    +
    ATTACAACAATTTATCAAGTA
    CTAGGTTGTTAAGTGGTTCAT
    miRferno
    MHK; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase
    25
    gma-miR4391
    6.0
    chr16:11150722-11150745
    +
    ATTTTTCTCGTTTCTTTTCCGAGA
    GAAGAAGAATCAAGAAACGGCTCT
    miRferno
    MHK; ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase
    26
    gma-miR172k
    4.5
    chr16:3094205-3094225
    -
    ATGCAGCAGCAGGAAGGTACA
    TACGTCGTAGTAGTTCTAAGT
    miRferno
    glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein
    27
    gma-miR9760
    4.5
    chr13:3745696-3745716
    +
    CAATCACAACAATAACTTCCA
    GTTAGTTTTGATGTAGTAGGT
    miRferno
    EIN3 (ETHYLENE-INSENSITIVE3); transcription factor
    28
    gma-miR5371-5p
    5
    chr9:46079256-46079276
    +
    TATCTGAGTTTCTAATACATA
    CTAGACTCACTGATTAAGGAT
    miRferno
    KAS III (3-KETOACYL-ACYL CARRIER PROTEIN SYNTHASE III); 3-oxoacyl-[acyl-carrier-protein] synthase/ catalytic/ transferase, transferring acyl groups other than amino-acyl groups
    29
    gma-miR395j;gma-miR395k;gma-miR395i;gma-miR395l;gm
    4.0
    chr11:35500386-35500406
    +
    TTTTTCTCTCAAACACTTCAT
    CTCAAGGGGGTTTGTGAAGTA
    miRferno
    glycosyl hydrolase family 17 protein
    30
    gma-miR1514a-5p
    3.5
    chr11:35504070-35504090
    +
    ATTGTTTATTTTAAAAATTAG
    TTACGGATAAAATTTTTACTT
    miRferno
    glycosyl hydrolase family 17 protein