Search By Other

 Search
 for  
 In 
       ?

Glycine max miRNA Target Genome sites

Total 377884 records in 12597 Pages. Current page: 2

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    gma-miR396j
    4.5
    chr9:21086948-21086968
    -
    CTTTGAACAGCTATATTGAGT
    AAAAGGTGTCGATAGAACTTA
    miRferno
    emsy N terminus domain-containing protein / ENT domain-containing protein
    2
    gma-miR171i-5p
    4.5
    chr7:3447401-3447420
    +
    TCTGACCATTGCTATCATGT
    AAACTCGTAACGAAAGAATA
    miRferno
    UBP1B (oligouridylate binding protein 1B); mRNA 3\'-UTR binding
    3
    gma-miR2606a;gma-miR2606b
    4.5
    chr9:44046321-44046341
    +
    TGCAGTTCCTTAGATGTTTTT
    ATGGCAAGGAATTCACGAAAA
    miRferno
    CXIP1 (CAX INTERACTING PROTEIN 1); antiporter/ glutathione disulfide oxidoreductase
    4
    gma-miR9724
    5.0
    chr15:49850329-49850350
    -
    CTCTATTTTGATTCTGTCTCGA
    AAGATAAAACTGTGATAGAGAT
    miRferno
    NRPB8B; DNA-directed RNA polymerase
    5
    gma-miR396g
    3.5
    chr17:39485323-39485343
    +
    GCTGCCGAAGAAGTTCAGGAA
    CTACGTATTCTTCAAGTTCTT
    miRferno
    protein binding
    6
    gma-miR5380c
    5.5
    chr8:41769136-41769156
    -
    AACTTCATCTTTTCCATTCAC
    GAGAAGTAGAAGTGGTAAGTA
    miRferno
    mitochondrial transcription termination factor family protein / mTERF family protein
    7
    gma-miR5380c
    4.5
    chr8:41768807-41768827
    -
    GTCTGCATCATCATCATTCAC
    GAGAAGTAGAAGTGGTAAGTA
    miRferno
    mitochondrial transcription termination factor family protein / mTERF family protein
    8
    gma-miR5037b
    4.5
    chr16:9058837-9058856
    -
    CAATGAGGCCATTGAGGGTG
    GATCCTTCGGAAACTCCCAA
    miRferno
    LOX5; electron carrier/ iron ion binding / lipoxygenase/ metal ion binding / oxidoreductase, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen
    9
    gma-miR2119
    4.5
    chr6:13380984-13381004
    +
    TCCCCTTAAAACTCAGTTTGA
    AAGGGGATGTTGAGGGAAACT
    miRferno
    RBOHD (RESPIRATORY BURST OXIDASE HOMOLOGUE D); NAD(P)H oxidase
    10
    gma-miR5375
    4.5
    chr6:13385511-13385532
    +
    GCTCCACAACTATTGCACTAGT
    CGAGGTGTTCATGAAGATATCA
    miRferno
    RBOHD (RESPIRATORY BURST OXIDASE HOMOLOGUE D); NAD(P)H oxidase
    11
    gma-miR1513a-3p
    3.5
    chr6:13384046-13384068
    +
    ACAATAATTTGTATACATTTAAA
    TGGTACTGAATATGTGTAAATTT
    miRferno
    RBOHD (RESPIRATORY BURST OXIDASE HOMOLOGUE D); NAD(P)H oxidase
    12
    gma-miR5368
    5
    chr19:36455434-36455452
    +
    TGTCCAAAAGAGACTTTCC
    ACAGATGGACTCTGACAGG
    miRferno
    adenylylsulfate kinase, putative
    13
    gma-miR4348b
    4.5
    chr19:36456815-36456835
    +
    TTTATAGACAAACTAAAAAGA
    GATTATCAGTTTAAGTTTTCT
    miRferno
    adenylylsulfate kinase, putative
    14
    gma-miR171k-3p
    5
    chr3:782521-782541
    +
    ATTTATATTGGCGCATCTGAA
    TCACTATAACCGCGCCGAGTT
    miRferno
    CYP86A8; fatty acid (omega-1)-hydroxylase/ oxygen binding
    15
    gma-miR1536
    4.5
    chr6:49142045-49142065
    -
    TAAATAATTTTGTCTCTTCTG
    ATTTGTGTAAACAGAGACGAA
    miRferno
    strictosidine synthase family protein
    16
    gma-miR396j
    5.0
    chr6:49139788-49139808
    -
    TTTTTCTTTTCTATCTTGAAT
    AAAAGGTGTCGATAGAACTTA
    miRferno
    strictosidine synthase family protein
    17
    gma-miR5775
    5.0
    chr12:36675870-36675890
    +
    GAAGATCTCAGAAGTATTTAT
    CTTCGAGAGTTTTCTCGAATA
    miRferno
    reticulon family protein
    18
    gma-miR167e;gma-miR167f
    4.5
    chr12:36675124-36675144
    +
    AAAATTATGCTGGTAGTCTCA
    TTCTAGTACGACCGTCGAAGT
    miRferno
    reticulon family protein
    19
    gma-miR171i-5p
    5
    chr8:1598171-1598190
    -
    TTTGTTCATTACTTTGTTTT
    AAACTCGTAACGAAAGAATA
    miRferno
    TRH1 (TINY ROOT HAIR 1); potassium ion transmembrane transporter
    20
    gma-miR5380c
    3.5
    chr8:1596704-1596724
    -
    GTTTTAATCTTGACCATTCAT
    GAGAAGTAGAAGTGGTAAGTA
    miRferno
    TRH1 (TINY ROOT HAIR 1); potassium ion transmembrane transporter
    21
    gma-miR1525
    3.5
    chr8:1597258-1597278
    -
    ACTCAAAGCTTAAATAATCTA
    TGATTTTTGAATTAATTGGGT
    miRferno
    TRH1 (TINY ROOT HAIR 1); potassium ion transmembrane transporter
    22
    gma-miR4415a-5p
    4.5
    chr8:1593134-1593154
    -
    CATTAAATATTATCACTACTT
    GTAACTAAGAGTAGTGTTGAA
    miRferno
    TRH1 (TINY ROOT HAIR 1); potassium ion transmembrane transporter
    23
    gma-miR4366
    5.5
    chr8:1596758-1596779
    -
    ACAACAAATCTTGACTATGTAA
    GGTTGTTTAGAGATGATTCATC
    miRferno
    TRH1 (TINY ROOT HAIR 1); potassium ion transmembrane transporter
    24
    gma-miR403a;gma-miR403b
    5
    chr8:1598549-1598569
    -
    CAAATTTGATCGTAAATGTAA
    GTTCAAACACGCACTTAGATT
    miRferno
    TRH1 (TINY ROOT HAIR 1); potassium ion transmembrane transporter
    25
    gma-miR396g
    4.5
    chr8:1595768-1595788
    -
    CATGCATAACAAGTGAAAGAG
    CTACGTATTCTTCAAGTTCTT
    miRferno
    TRH1 (TINY ROOT HAIR 1); potassium ion transmembrane transporter
    26
    gma-miR399f;gma-miR399g;gma-miR399d;gma-miR399e
    4.0
    chr11:6999707-6999727
    +
    CTGGGCAAATTTCTATTAGCA
    GACCCGTTTAGAGGAAACCGT
    miRferno
    ATARFB1B; GTP binding
    27
    gma-miR5370
    5.0
    chr8:14803014-14803034
    -
    TTTCTTTTGTTGAATCTTTAC
    AAGGAAAACCTGTTAGAAATC
    miRferno
    bZIP transcription factor family protein
    28
    gma-miR5775
    5
    chr5:31320795-31320815
    -
    TAAGCTATAAACAGAGCTTCT
    CTTCGAGAGTTTTCTCGAATA
    miRferno
    EDA14 (EMBRYO SAC DEVELOPMENT ARREST 14)
    29
    gma-miR167d;gma-miR167a;gma-miR167b
    4.5
    chr11:34200495-34200515
    +
    CATATGATGCTGGCTGTTTCA
    ATCTAGTACGACCGTCGAAGT
    miRferno
    protein kinase family protein
    30
    gma-miR5559
    4.5
    chr11:34200450-34200470
    +
    GATACAACAACTTACAAAGTT
    CTAGGTTGTTAAGTGGTTCAT
    miRferno
    protein kinase family protein