Search By Other

 Search
 for  
 In 
       ?

Glycine max miRNA Target Genome sites

Total 377884 records in 12597 Pages. Current page: 3

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    gma-miR167e;gma-miR167f
    4.5
    chr11:34200495-34200515
    +
    CATATGATGCTGGCTGTTTCA
    TTCTAGTACGACCGTCGAAGT
    miRferno
    protein kinase family protein
    2
    gma-miR1514a-5p
    5.5
    chr11:34201654-34201674
    +
    AATAATTTTTTTAAAAATCAA
    TTACGGATAAAATTTTTACTT
    miRferno
    protein kinase family protein
    3
    gma-miR4348b
    4.5
    chr2:2414936-2414956
    -
    TTAATAATCAAATTAAAAATC
    GATTATCAGTTTAAGTTTTCT
    miRferno
    GLP7 (GERMIN-LIKE PROTEIN 7); manganese ion binding / nutrient reservoir
    4
    gma-miR1514a-5p
    5.0
    chr4:48318013-48318033
    -
    AATTATTATTATAAAAATGAG
    TTACGGATAAAATTTTTACTT
    miRferno
    BGAL16 (beta-galactosidase 16); beta-galactosidase/ catalytic/ cation binding / sugar binding
    5
    gma-miR390e
    5.0
    chr2:15188430-15188449
    +
    GGCCCTGAGCTTCCTGAGCT
    CCGCGATAGGGAGGACTCGA
    miRferno
    unknown protein
    6
    gma-miR9764
    5
    chr2:15188268-15188288
    +
    GAGAAAGTCAAAGTCAAGCCA
    CTCTTTCATTCTCACATAGGT
    miRferno
    unknown protein
    7
    gma-miR4387d
    7.0
    chr2:15186202-15186225
    +
    ATGGTAATGCCTAATCAGTGAAGG
    TAGTAGTACGGATTAGTCACTGTA
    miRferno
    unknown protein
    8
    gma-miR171i-5p
    5.0
    chr3:43881921-43881940
    -
    TTTTACTGTTGCTTTCATAT
    AAACTCGTAACGAAAGAATA
    miRferno
    transducin family protein / WD-40 repeat family protein
    9
    gma-miR1520e
    5.5
    chr5:1715938-1715961
    +
    ATGTCATGTGTAACTTTCTCATTA
    GACAGTATACAGTGCAAGAATAAC
    miRferno
    unknown protein
    10
    gma-miR4348b
    5
    chr15:7818672-7818692
    +
    CTCATTCTCAAATTCACCAGA
    GATTATCAGTTTAAGTTTTCT
    miRferno
    unknown protein
    11
    gma-miR5037b
    5
    chr15:7824096-7824115
    +
    CAATGAAGCCTTAGATCGTT
    GATCCTTCGGAAACTCCCAA
    miRferno
    unknown protein
    12
    gma-miR4415a-5p
    5.5
    chr15:7820671-7820691
    +
    CTTTGATGCTCATCTCAATAT
    GTAACTAAGAGTAGTGTTGAA
    miRferno
    unknown protein
    13
    gma-miR1514a-5p
    5.0
    chr15:7822965-7822985
    +
    CGTGCTTCTTTTAAAAATAAA
    TTACGGATAAAATTTTTACTT
    miRferno
    unknown protein
    14
    gma-miR5370
    5
    chr15:7816781-7816801
    +
    TTCCTTTACGTCAATCTTCCG
    AAGGAAAACCTGTTAGAAATC
    miRferno
    unknown protein
    15
    gma-miR9745
    5.0
    chr5:30988735-30988758
    -
    GTTATACATTCCCAGTTTAAGTTT
    CAATATGCCAGGTTTAAATTAAGA
    miRferno
    BAK1 (BRI1-ASSOCIATED RECEPTOR KINASE); kinase/ protein binding / protein heterodimerization/ protein serine/threonine kinase
    16
    gma-miR2606a;gma-miR2606b
    5
    chr5:30988013-30988033
    -
    CACCGTTACTTCACTGCATTT
    ATGGCAAGGAATTCACGAAAA
    miRferno
    BAK1 (BRI1-ASSOCIATED RECEPTOR KINASE); kinase/ protein binding / protein heterodimerization/ protein serine/threonine kinase
    17
    gma-miR169j-3p
    4.5
    chr5:30993234-30993254
    -
    GCGATGAGCAACTAGTCGAAT
    CGGTTCTTGTTGAGCAGCTTT
    miRferno
    BAK1 (BRI1-ASSOCIATED RECEPTOR KINASE); kinase/ protein binding / protein heterodimerization/ protein serine/threonine kinase
    18
    gma-miR5773
    4.5
    chr5:30991212-30991233
    -
    GCCTAACTCAACCTTACAAAAC
    TGGATTGACTTGGAAAATTTTT
    miRferno
    BAK1 (BRI1-ASSOCIATED RECEPTOR KINASE); kinase/ protein binding / protein heterodimerization/ protein serine/threonine kinase
    19
    gma-miR1520d
    4.5
    chr16:6257985-6258006
    +
    TAGTCACGTGACATTTTTTTAT
    AACAGTGCACAGTACAAGACTA
    miRferno
    unknown protein
    20
    gma-miR162a
    5
    chr16:6258467-6258486
    +
    TGGATGCAGAAGTAAAAGGA
    ACCTACGTCTCCAAATAGCT
    miRferno
    unknown protein
    21
    gma-miR171i-5p
    5.5
    chr11:15977284-15977303
    +
    TTGGAGAGTTGATTTCTGAT
    AAACTCGTAACGAAAGAATA
    miRferno
    MFP1 (MAR BINDING FILAMENT-LIKE PROTEIN 1); DNA binding
    22
    gma-miR159b-5p;gma-miR159f-5p
    5
    chr11:15974636-15974656
    +
    AAATTGGATTTCAGGGACCTC
    CTGAACCTCACGTCCCTTGAG
    miRferno
    MFP1 (MAR BINDING FILAMENT-LIKE PROTEIN 1); DNA binding
    23
    gma-miR1508c
    4.5
    chr10:43835840-43835860
    +
    CAACAGCTTTATCCCTTTATG
    GTTGACGATAAAGGGAAAGAT
    miRferno
    emb1997 (embryo defective 1997); anthranilate synthase/ catalytic/ oxo-acid-lyase
    24
    gma-miR1520d
    5
    chr10:43837824-43837845
    +
    ATGCCACTTTTCATTTTCTGAT
    AACAGTGCACAGTACAAGACTA
    miRferno
    emb1997 (embryo defective 1997); anthranilate synthase/ catalytic/ oxo-acid-lyase
    25
    gma-miR171i-5p
    5.5
    chr10:43840257-43840276
    +
    TTTTAATATTTCTTTATTAT
    AAACTCGTAACGAAAGAATA
    miRferno
    emb1997 (embryo defective 1997); anthranilate synthase/ catalytic/ oxo-acid-lyase
    26
    gma-miR1507c-5p
    5.5
    chr10:43839221-43839241
    +
    TTCTCGCATATCACACTCCTC
    AAGAGAGTAGGGTTTGTGGAG
    miRferno
    emb1997 (embryo defective 1997); anthranilate synthase/ catalytic/ oxo-acid-lyase
    27
    gma-miR1520m
    6.5
    chr10:43837823-43837846
    +
    GATGCCACTTTTCATTTTCTGATT
    TAACAGTGTACAGTACAAGACTAA
    miRferno
    emb1997 (embryo defective 1997); anthranilate synthase/ catalytic/ oxo-acid-lyase
    28
    gma-miR9722
    5.5
    chr9:44053779-44053799
    -
    TTCAATTTGTTCCCTCGAATA
    AAGTAGAAGAAGGGAGATAAT
    miRferno
    unknown protein
    29
    gma-miR9766
    5.5
    chr9:44052525-44052545
    -
    TTTTCTTTCCTTCCTACCAAA
    CAAAGTAAGGAAGGGAAGTTT
    miRferno
    unknown protein
    30
    gma-miR167e;gma-miR167f
    4.5
    chr11:36804281-36804301
    -
    AAGAACATCCTGGCTGTTGCA
    TTCTAGTACGACCGTCGAAGT
    miRferno
    60S acidic ribosomal protein P0 (RPP0C)