Search By Other

 Search
 for  
 In 
       ?

Glycine max miRNA Target Genome sites

Total 377884 records in 12597 Pages. Current page: 4

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    gma-miR1508c
    3.5
    chr18:42209896-42209916
    -
    CTATTGCTATTTTTCTTTCTT
    GTTGACGATAAAGGGAAAGAT
    miRferno
    GPI transamidase component PIG-S-related
    2
    gma-miR171i-5p
    4
    chr18:42207302-42207321
    -
    TTTGAGCACTGCTTTGCCAT
    AAACTCGTAACGAAAGAATA
    miRferno
    GPI transamidase component PIG-S-related
    3
    gma-miR4415a-5p
    5.5
    chr10:39023251-39023271
    -
    CCTTGTTTCTCATAACAATAT
    GTAACTAAGAGTAGTGTTGAA
    miRferno
    ATB2; oxidoreductase
    4
    gma-miR9722
    4.5
    chr10:39022369-39022389
    -
    TTCTTCTCTTTTCCTTTATTA
    AAGTAGAAGAAGGGAGATAAT
    miRferno
    ATB2; oxidoreductase
    5
    gma-miR9766
    4.0
    chr10:39023510-39023530
    -
    GTTTCATTCCTTTCTTCCTAC
    CAAAGTAAGGAAGGGAAGTTT
    miRferno
    ATB2; oxidoreductase
    6
    gma-miR1512a-5p
    4.5
    chr10:39023903-39023924
    -
    CTATTTTAATAATTTTAAGTTT
    TATGAAATTCTTAAAAGTCAAT
    miRferno
    ATB2; oxidoreductase
    7
    gma-miR171i-5p
    4.5
    chr10:42825293-42825312
    -
    TGGGACCATTGGTTTCTTGT
    AAACTCGTAACGAAAGAATA
    miRferno
    zinc finger (C3HC4-type RING finger) family protein
    8
    gma-miR5775
    5.5
    chr13:23541622-23541642
    -
    GAAGCACGCAAAAGAGCTAGA
    CTTCGAGAGTTTTCTCGAATA
    miRferno
    iqd2 (IQ-domain 2); calmodulin binding
    9
    gma-miR5784
    4.5
    chr13:23540688-23540708
    -
    TCAGCAAATCATTTGCTAAGT
    AATCGATTGGTAATCGATTAA
    miRferno
    iqd2 (IQ-domain 2); calmodulin binding
    10
    gma-miR167i
    4.5
    chr20:41665100-41665122
    -
    AGCATTTGAAGTTGCGAGCTTGA
    TGGTCAACTTCGACGGTCGTACT
    miRferno
    unknown protein
    11
    gma-miR5368
    6.0
    chr17:11106083-11106101
    +
    TGTCTGACTGATACTGCTC
    ACAGATGGACTCTGACAGG
    miRferno
    GAE5 (UDP-D-GLUCURONATE 4-EPIMERASE 5); UDP-glucuronate 4-epimerase/ catalytic
    12
    gma-miR1508c
    4.5
    chr6:25508036-25508056
    +
    CAACTTCTGTTTCACATTCTT
    GTTGACGATAAAGGGAAAGAT
    miRferno
    WRKY32; transcription factor
    13
    gma-miR171b-3p
    5
    chr6:25512299-25512319
    +
    GAAAGCAATTGAGTCGGCTCG
    CTCACTATAACTAAGCCGAGC
    miRferno
    WRKY32; transcription factor
    14
    gma-miR2107
    4.5
    chr6:30699554-30699574
    -
    GATACAGGTTACAGAGTTCTT
    CTATGTCCGATGCCTCCAAAC
    miRferno
    unknown protein
    15
    gma-miR2606a;gma-miR2606b
    5
    chr6:30697849-30697869
    -
    TACCCTTGATTTATTGCTTTT
    ATGGCAAGGAATTCACGAAAA
    miRferno
    unknown protein
    16
    gma-miR1514a-5p
    5.0
    chr6:30694830-30694850
    -
    AATCTCTATTTTTAAGAGGAA
    TTACGGATAAAATTTTTACTT
    miRferno
    unknown protein
    17
    gma-miR5370
    5
    chr9:38443210-38443230
    -
    TTCCTTTTGCACAATCATATT
    AAGGAAAACCTGTTAGAAATC
    miRferno
    FAH1 (FERULIC ACID 5-HYDROXYLASE 1); ferulate 5-hydroxylase/ monooxygenase
    18
    gma-miR171i-5p
    4.5
    chr10:49672835-49672854
    -
    TCTGAATATTGCTTTTTTGT
    AAACTCGTAACGAAAGAATA
    miRferno
    unknown protein
    19
    gma-miR5037b
    4.0
    chr8:13133913-13133932
    +
    CTATGAGGCTTATGAAGGTT
    GATCCTTCGGAAACTCCCAA
    miRferno
    DEAD/DEAH box helicase, putative
    20
    gma-miR1523a
    4.5
    chr18:42311204-42311223
    +
    TTAACTCAAATTGATCCTAT
    ACTCGAGTGTAAATAGGGTA
    miRferno
    RIN4 (RPM1 INTERACTING PROTEIN 4); protein binding
    21
    gma-miR171i-5p
    5
    chr18:42307547-42307566
    +
    TTTGCTAATTTCTTTCTCAT
    AAACTCGTAACGAAAGAATA
    miRferno
    RIN4 (RPM1 INTERACTING PROTEIN 4); protein binding
    22
    gma-miR5368
    5.5
    chr18:42310467-42310485
    +
    AGTCTTTATGAGACTTTCC
    ACAGATGGACTCTGACAGG
    miRferno
    RIN4 (RPM1 INTERACTING PROTEIN 4); protein binding
    23
    gma-miR390e
    4.5
    chr6:14317977-14317996
    -
    CTCACTGTCCCACCTGAGCT
    CCGCGATAGGGAGGACTCGA
    miRferno
    CPI1 (CYCLOPROPYL ISOMERASE); cycloeucalenol cycloisomerase
    24
    gma-miR396c;gma-miR396b-5p;gma-miR396k-5p
    5.0
    chr6:14315379-14315399
    -
    AGGTTCAAGATATTTGTGCAA
    TTCAAGTTCTTTCGACACCTT
    miRferno
    CPI1 (CYCLOPROPYL ISOMERASE); cycloeucalenol cycloisomerase
    25
    gma-miR394a-3p
    5
    chr13:10897537-10897556
    +
    TTAGTGTATCCAAAATAGCT
    TTTCACATCGGTTGTCTCGA
    miRferno
    tetratricopeptide repeat (TPR)-containing protein
    26
    gma-miR396j
    5.5
    chr13:10900958-10900978
    +
    TTTTCAACAAGGATCTTGATT
    AAAAGGTGTCGATAGAACTTA
    miRferno
    tetratricopeptide repeat (TPR)-containing protein
    27
    gma-miR396g
    3.5
    chr13:10898978-10898998
    +
    GAAGCATGGGAAGTTCAGGAC
    CTACGTATTCTTCAAGTTCTT
    miRferno
    tetratricopeptide repeat (TPR)-containing protein
    28
    gma-miR4372a
    6.0
    chr15:3772995-3773018
    -
    TCGCCGTCACATGTCACTATTTGG
    ACTGGCAGTGTACAGTGCTAAAAT
    miRferno
    unknown protein
    29
    gma-miR5677
    5.5
    chr15:3773555-3773575
    -
    TCAGCATGATTATAAAGTAAA
    AGTCGAACTAATTTCTGGTTT
    miRferno
    unknown protein
    30
    gma-miR5368
    4
    chr13:280722-280740
    -
    TGTATACATGAGAATGTAC
    ACAGATGGACTCTGACAGG
    miRferno
    PRHA (PATHOGENESIS RELATED HOMEODOMAIN PROTEIN A); protein binding / sequence-specific DNA binding / transcription activator/ transcription factor