Search By Other

 Search
 for  
 In 
       ?

Glycine max miRNA Target Genome sites

Total 377884 records in 12597 Pages. Current page: 5

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    gma-miR171i-5p
    6.0
    chr13:10678188-10678207
    +
    TTTTGATATTGCTTTCTTAG
    AAACTCGTAACGAAAGAATA
    miRferno
    VHS domain-containing protein / GAT domain-containing protein
    2
    gma-miR162a
    4.5
    chr13:10682468-10682487
    +
    TGGATTCACAGTTATATCGG
    ACCTACGTCTCCAAATAGCT
    miRferno
    VHS domain-containing protein / GAT domain-containing protein
    3
    gma-miR1536
    5
    chr13:10681196-10681216
    +
    CAAACAAATCTCTCTCTCCTT
    ATTTGTGTAAACAGAGACGAA
    miRferno
    VHS domain-containing protein / GAT domain-containing protein
    4
    gma-miR5368
    4.5
    chr14:45870672-45870690
    -
    TGTATGCATAATACTGTCC
    ACAGATGGACTCTGACAGG
    miRferno
    MAB1 (MACCI-BOU); catalytic/ pyruvate dehydrogenase (acetyl-transferring)
    5
    gma-miR397a;gma-miR397b-5p
    5.0
    chr14:45874785-45874805
    -
    TCTCAACTCCGCACTCGATGA
    GTAGTTGCGACGTGAGTTACT
    miRferno
    MAB1 (MACCI-BOU); catalytic/ pyruvate dehydrogenase (acetyl-transferring)
    6
    gma-miR5677
    4.0
    chr14:45875098-45875118
    -
    TTTGCTTGATTGAAGATCAAG
    AGTCGAACTAATTTCTGGTTT
    miRferno
    MAB1 (MACCI-BOU); catalytic/ pyruvate dehydrogenase (acetyl-transferring)
    7
    gma-miR171i-5p
    5
    chr11:15770609-15770628
    +
    TTTCAGGATTGATTTCTTCC
    AAACTCGTAACGAAAGAATA
    miRferno
    AIR3; serine-type endopeptidase
    8
    gma-miR9766
    5.0
    chr11:15770615-15770635
    +
    GATTGATTTCTTCCCTTTCAA
    CAAAGTAAGGAAGGGAAGTTT
    miRferno
    AIR3; serine-type endopeptidase
    9
    gma-miR1512a-5p
    5
    chr11:15770745-15770766
    +
    ATACCTTAAGAAAATGCATTTA
    TATGAAATTCTTAAAAGTCAAT
    miRferno
    AIR3; serine-type endopeptidase
    10
    gma-miR4414-3p
    4.5
    chr1:20714063-20714082
    +
    GCAGCGGGCTCATCGTTGGG
    CGTCGAGGGCGTAGCAACCT
    miRferno
    DegP9 (DegP protease 9); catalytic/ protein binding / serine-type endopeptidase/ serine-type peptidase
    11
    gma-miR9744
    4.5
    chr1:20714807-20714827
    +
    TGTATGCCCCGCTTGTCCATT
    ACATACGTCGAGTATAGGTAA
    miRferno
    DegP9 (DegP protease 9); catalytic/ protein binding / serine-type endopeptidase/ serine-type peptidase
    12
    gma-miR1520f-3p
    5.5
    chr19:40405527-40405550
    +
    CTGTCATTTGTTATTATGTGATTG
    AACAGTACACAGTACAAGACTAAC
    miRferno
    40S ribosomal protein S20 (RPS20C)
    13
    gma-miR167e;gma-miR167f
    5
    chr19:40405571-40405591
    +
    ATGATCATTCTTGCAGCCTGA
    TTCTAGTACGACCGTCGAAGT
    miRferno
    40S ribosomal protein S20 (RPS20C)
    14
    gma-miR1520k
    5.5
    chr19:40405526-40405549
    +
    TCTGTCATTTGTTATTATGTGATT
    TGACAGTACACAGTACAAGACTAA
    miRferno
    40S ribosomal protein S20 (RPS20C)
    15
    gma-miR4996
    4
    chr10:38855569-38855588
    -
    GAGAAGATTTGGATCTTCTA
    CTCTTGTACCCCTCGAAGAT
    miRferno
    CYSD1 (CYSTEINE SYNTHASE D1); cysteine synthase
    16
    gma-miR1507c-5p
    3.5
    chr10:38855809-38855829
    -
    TTCTCTAATCCCAAATATTTA
    AAGAGAGTAGGGTTTGTGGAG
    miRferno
    CYSD1 (CYSTEINE SYNTHASE D1); cysteine synthase
    17
    gma-miR5380c
    4.0
    chr10:38854723-38854743
    -
    TTATTTATCTTCACCATTGTT
    GAGAAGTAGAAGTGGTAAGTA
    miRferno
    CYSD1 (CYSTEINE SYNTHASE D1); cysteine synthase
    18
    gma-miR5372
    5.5
    chr10:38855482-38855502
    -
    CACAACAATTGTCGTGAACAA
    GTGTTGTCAAAATAGCTTGTT
    miRferno
    CYSD1 (CYSTEINE SYNTHASE D1); cysteine synthase
    19
    gma-miR1514a-5p
    3.0
    chr8:28231405-28231425
    +
    GATTCCTATTTTGAAGATGGA
    TTACGGATAAAATTTTTACTT
    miRferno
    RAD23-3 (PUTATIVE DNA REPAIR PROTEIN RAD23-3); damaged DNA binding
    20
    gma-miR1514a-5p
    4.5
    chr8:28224640-28224660
    +
    TTTTCCTATTTTGAAAAGGAA
    TTACGGATAAAATTTTTACTT
    miRferno
    RAD23-3 (PUTATIVE DNA REPAIR PROTEIN RAD23-3); damaged DNA binding
    21
    gma-miR9760
    5.5
    chr8:28226260-28226280
    +
    CCATCAAACCTACATCTCTCA
    GTTAGTTTTGATGTAGTAGGT
    miRferno
    RAD23-3 (PUTATIVE DNA REPAIR PROTEIN RAD23-3); damaged DNA binding
    22
    gma-miR4414-3p
    5.0
    chr19:48369822-48369841
    -
    GCAGCTCTTCCATGGATGGA
    CGTCGAGGGCGTAGCAACCT
    miRferno
    ATP binding / microtubule motor
    23
    gma-miR156aa;gma-miR156z
    3.5
    chr13:25905034-25905051
    +
    AACACCCTTCGCTCCAAC
    TCGAGGGAAGTGAGGTTA
    miRferno
    glycosyl hydrolase family 18 protein
    24
    gma-miR396c;gma-miR396b-5p;gma-miR396k-5p
    5.0
    chr7:38391804-38391824
    -
    AACTTCAAGGAATTTATGGAA
    TTCAAGTTCTTTCGACACCTT
    miRferno
    calmodulin-related protein, putative
    25
    gma-miR396g
    5.5
    chr7:38391699-38391719
    -
    AGTGCTGAAGAAGTTAAAGAA
    CTACGTATTCTTCAAGTTCTT
    miRferno
    calmodulin-related protein, putative
    26
    gma-miR9760
    4.5
    chr6:49168545-49168565
    -
    AGATGAAAGCTATATCATCCA
    GTTAGTTTTGATGTAGTAGGT
    miRferno
    proline-rich family protein
    27
    gma-miR171c-3p;gma-miR171o-3p;gma-miR171q
    5
    chr10:612855-612875
    +
    TATCATATAGGCAAGGCTCTA
    ACACTATAACCGTGCCGAGTT
    miRferno
    dehydration-responsive protein-related
    28
    gma-miR4996
    5.0
    chr13:38402769-38402788
    -
    GAGACCGGGGGGAGTTTGTA
    CTCTTGTACCCCTCGAAGAT
    miRferno
    ATTPC1 (TWO-PORE CHANNEL 1); calcium channel/ voltage-gated calcium channel
    29
    gma-miR5677
    3.0
    chr13:38402220-38402240
    -
    TTGGCTTGGTTAAAGACTAAT
    AGTCGAACTAATTTCTGGTTT
    miRferno
    ATTPC1 (TWO-PORE CHANNEL 1); calcium channel/ voltage-gated calcium channel
    30
    gma-miR1508c
    5.0
    chr10:6190461-6190481
    -
    CAATTGCTTTTTCCCTTCTAA
    GTTGACGATAAAGGGAAAGAT
    miRferno
    pyruvate kinase, putative