Search By Other

 Search
 for  
 In 
       ?

Glycine max miRNA Target Genome sites

Total 377884 records in 12597 Pages. Current page: 6

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    gma-miR1514a-5p
    5
    chr10:6187088-6187108
    -
    AATGAATATTTTATAAATAAT
    TTACGGATAAAATTTTTACTT
    miRferno
    pyruvate kinase, putative
    2
    gma-miR9722
    3.5
    chr7:44483867-44483887
    +
    ATCTTCTACTTCCTTCTATTA
    AAGTAGAAGAAGGGAGATAAT
    miRferno
    AtHB31 (ARABIDOPSIS THALIANA HOMEOBOX PROTEIN 31); DNA binding / transcription factor
    3
    gma-miR5371-3p
    4.0
    chr7:13905368-13905388
    -
    TCTTGGAATTAATCATTGAAA
    AGATCTTTAATCAGTGACTCT
    miRferno
    CYP51G1 (CYTOCHROME P450 51G1); oxygen binding / sterol 14-demethylase
    4
    gma-miR9760
    5
    chr7:13906025-13906045
    -
    CAATCAAAACCACAAAACACA
    GTTAGTTTTGATGTAGTAGGT
    miRferno
    CYP51G1 (CYTOCHROME P450 51G1); oxygen binding / sterol 14-demethylase
    5
    gma-miR4382
    3.5
    chr19:37607473-37607494
    +
    ATTTATCAAATTAGTTAAAATA
    TAGGTACTTTAGTCAATTGTAT
    miRferno
    IMS1 (2-ISOPROPYLMALATE SYNTHASE 1); 2-isopropylmalate synthase
    6
    gma-miR171i-5p
    3.5
    chr19:37618039-37618058
    +
    CTTGAGCATTGGCTTCTTGT
    AAACTCGTAACGAAAGAATA
    miRferno
    IMS1 (2-ISOPROPYLMALATE SYNTHASE 1); 2-isopropylmalate synthase
    7
    gma-miR4348b
    4.5
    chr19:37608018-37608038
    +
    CCAAAAATTAAATTCAATAGA
    GATTATCAGTTTAAGTTTTCT
    miRferno
    IMS1 (2-ISOPROPYLMALATE SYNTHASE 1); 2-isopropylmalate synthase
    8
    gma-miR1525
    3.5
    chr19:37602621-37602641
    +
    AATAAAATCTTGATAAACCCA
    TGATTTTTGAATTAATTGGGT
    miRferno
    IMS1 (2-ISOPROPYLMALATE SYNTHASE 1); 2-isopropylmalate synthase
    9
    gma-miR396j
    5
    chr19:37612975-37612995
    +
    TTTTCCACAGCTTTGATCAAA
    AAAAGGTGTCGATAGAACTTA
    miRferno
    IMS1 (2-ISOPROPYLMALATE SYNTHASE 1); 2-isopropylmalate synthase
    10
    gma-miR396g
    5
    chr19:37619324-37619344
    +
    CATGCATAATTAGTTATAGAA
    CTACGTATTCTTCAAGTTCTT
    miRferno
    IMS1 (2-ISOPROPYLMALATE SYNTHASE 1); 2-isopropylmalate synthase
    11
    gma-miR9738
    4.5
    chr19:37604045-37604066
    +
    GAAGAGTCCACAGTGTCTTTCG
    CTTCTCAGGTGTAGTACAAAGT
    miRferno
    IMS1 (2-ISOPROPYLMALATE SYNTHASE 1); 2-isopropylmalate synthase
    12
    gma-miR171i-5p
    4.5
    chr1:50396984-50397003
    -
    GTTGAGGATTTCTTTTTTAA
    AAACTCGTAACGAAAGAATA
    miRferno
    TTN5 (TITAN 5); GTP binding / GTPase
    13
    gma-miR1507c-5p
    5.5
    chr17:6605518-6605538
    -
    GTCACTCATCGTAAACCCCTC
    AAGAGAGTAGGGTTTGTGGAG
    miRferno
    MBP2C (MICROTUBULE BINDING PROTEIN 2C); protein binding
    14
    gma-miR319m;gma-miR319j;gma-miR319k;gma-miR319h
    4.5
    chr17:6601938-6601958
    -
    AGTTAGGTCCCTTTAGTCAAA
    TCCCTCGAGGGAAGTCAGGTT
    miRferno
    MBP2C (MICROTUBULE BINDING PROTEIN 2C); protein binding
    15
    gma-miR1523a
    5
    chr8:11127950-11127969
    +
    TCTCCTAACTTTTATCCCAT
    ACTCGAGTGTAAATAGGGTA
    miRferno
    EMB2107 (EMBRYO DEFECTIVE 2107)
    16
    gma-miR156b
    4.5
    chr8:11125805-11125825
    +
    TGTGTTCACTCTCTTCACTCT
    ACACGAGAGAGAGAAGACAGT
    miRferno
    EMB2107 (EMBRYO DEFECTIVE 2107)
    17
    gma-miR5371-3p
    4.5
    chr5:39815915-39815935
    -
    TTTAGAAACTAGTCACTTTAA
    AGATCTTTAATCAGTGACTCT
    miRferno
    initiator tRNA phosphoribosyl transferase family protein
    18
    gma-miR171c-3p;gma-miR171o-3p;gma-miR171q
    5.5
    chr5:39818522-39818542
    -
    TTGGCAGTTGGCACGGCTCAA
    ACACTATAACCGTGCCGAGTT
    miRferno
    initiator tRNA phosphoribosyl transferase family protein
    19
    gma-miR171j-3p;gma-miR171u;gma-miR171f;gma-miR171g
    5.5
    chr5:39818519-39818539
    -
    GCAGTTGGCACGGCTCAAGCT
    CTATAACCGTGCCGAGTTAGT
    miRferno
    initiator tRNA phosphoribosyl transferase family protein
    20
    gma-miR4394
    4.5
    chr16:35568395-35568418
    +
    CGGCCTCTTTCTCTCTCTTCCCTT
    GCCGGGGAAAGAGAAATCAGGTAA
    miRferno
    PEPKR1 (Phosphoenolpyruvate carboxylase-related kinase 1); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase
    21
    gma-miR4348b
    5.5
    chr12:9889595-9889615
    -
    CTTGTAGTATAATTCACAAGA
    GATTATCAGTTTAAGTTTTCT
    miRferno
    secretory carrier membrane protein (SCAMP) family protein
    22
    gma-miR1536
    5
    chr12:9888896-9888916
    -
    TTAACAGACTTGTCTCTCCAT
    ATTTGTGTAAACAGAGACGAA
    miRferno
    secretory carrier membrane protein (SCAMP) family protein
    23
    gma-miR172k
    5.5
    chr12:9892795-9892815
    -
    ATGCAATAACATCAAGTTTCT
    TACGTCGTAGTAGTTCTAAGT
    miRferno
    secretory carrier membrane protein (SCAMP) family protein
    24
    gma-miR171i-5p
    5
    chr3:45364443-45364462
    +
    TTTTAGCACTTCTTTCCTAG
    AAACTCGTAACGAAAGAATA
    miRferno
    calmodulin-binding protein
    25
    gma-miR1525
    2.5
    chr7:44380429-44380449
    +
    ACTAAAATCTAAATTAACTCA
    TGATTTTTGAATTAATTGGGT
    miRferno
    leucine-rich repeat family protein / protein kinase family protein
    26
    gma-miR1536
    5
    chr7:44379334-44379354
    +
    TACACACATATATCTCTTCTG
    ATTTGTGTAAACAGAGACGAA
    miRferno
    leucine-rich repeat family protein / protein kinase family protein
    27
    gma-miR9722
    5.0
    chr6:49444967-49444987
    -
    TTCATCTCTTTCACTTTATTT
    AAGTAGAAGAAGGGAGATAAT
    miRferno
    CRK10 (CYSTEINE-RICH RLK10); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase
    28
    gma-miR1514a-5p
    5.5
    chr6:49445694-49445714
    -
    AATTTCTATTTAAAAAATAAT
    TTACGGATAAAATTTTTACTT
    miRferno
    CRK10 (CYSTEINE-RICH RLK10); ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase
    29
    gma-miR1520p
    5.5
    chr7:41189049-41189072
    +
    ACTGCCATCCACCATTAACAACAC
    TGGCAGTAGTAGGTTATTGTTGTA
    miRferno
    zinc finger (C3HC4-type RING finger) family protein
    30
    gma-miR4415a-5p
    3.5
    chr7:41187655-41187675
    +
    CATTCATTGTCACCACAATTT
    GTAACTAAGAGTAGTGTTGAA
    miRferno
    zinc finger (C3HC4-type RING finger) family protein