Search By Other

 Search
 for  
 In 
       ?

Glycine max miRNA Target Genome sites

Total 377884 records in 12597 Pages. Current page: 7

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    gma-miR396g
    4
    chr7:41189386-41189406
    +
    GATGCATATGAAGACCTAGAA
    CTACGTATTCTTCAAGTTCTT
    miRferno
    zinc finger (C3HC4-type RING finger) family protein
    2
    gma-miR156e;gma-miR156d;gma-miR156c;gma-miR156m;gm
    3.5
    chr9:43840220-43840240
    -
    GTGGTGTCTATCTTTTGTTGA
    CACGAGAGATAGAAGACAGTT
    miRferno
    unknown protein
    3
    gma-miR162a
    5
    chr9:43841488-43841507
    -
    TTCATGAAGAAGTTTATCCA
    ACCTACGTCTCCAAATAGCT
    miRferno
    unknown protein
    4
    gma-miR1508b
    5.0
    chr9:43840927-43840947
    -
    TAACAGCAGTTCCCCTTTGTA
    GTTGACGATAAGGGGAAAGAT
    miRferno
    unknown protein
    5
    gma-miR9766
    2.5
    chr9:43842335-43842355
    -
    GTTTCATTACTTCTCTTCATA
    CAAAGTAAGGAAGGGAAGTTT
    miRferno
    unknown protein
    6
    gma-miR171i-5p
    5.5
    chr11:36370201-36370220
    -
    TTTGAGCATAACTTGGTGAT
    AAACTCGTAACGAAAGAATA
    miRferno
    proton-dependent oligopeptide transport (POT) family protein
    7
    gma-miR1536
    5
    chr11:36370281-36370301
    -
    TAAACTCTCTTCTCTCTTCTT
    ATTTGTGTAAACAGAGACGAA
    miRferno
    proton-dependent oligopeptide transport (POT) family protein
    8
    gma-miR171i-5p
    4.5
    chr18:1093972-1093991
    +
    TTTGATGTTTGTTTTGTTAT
    AAACTCGTAACGAAAGAATA
    miRferno
    histone H3.2
    9
    gma-miR1520f-3p
    6.5
    chr18:1094616-1094639
    +
    TTGTAATGTGTGTTGTTATTGTTG
    AACAGTACACAGTACAAGACTAAC
    miRferno
    histone H3.2
    10
    gma-miR171i-5p
    4.5
    chr20:40183884-40183903
    -
    TCTGAGAATTGCTTTTATAT
    AAACTCGTAACGAAAGAATA
    miRferno
    heat shock protein binding
    11
    gma-miR171i-5p
    5.0
    chr20:40186464-40186483
    -
    TTTTATTATTGTTTTCTTCT
    AAACTCGTAACGAAAGAATA
    miRferno
    heat shock protein binding
    12
    gma-miR171i-5p
    4.5
    chr20:40186117-40186136
    -
    TGTGAACTTTGTTATCTTAT
    AAACTCGTAACGAAAGAATA
    miRferno
    heat shock protein binding
    13
    gma-miR5370
    4.5
    chr20:40186196-40186216
    -
    CTCCTCTTGGAAAATTTTCAG
    AAGGAAAACCTGTTAGAAATC
    miRferno
    heat shock protein binding
    14
    gma-miR2606a;gma-miR2606b
    3.0
    chr2:46158959-46158979
    -
    TGCAGTTCTTTACGTGCTTTT
    ATGGCAAGGAATTCACGAAAA
    miRferno
    unknown protein
    15
    gma-miR4364b
    6.0
    chr8:9528379-9528402
    +
    AAGAAGGTTTTTCCATCTTTATTA
    TTCTTCCAAGAAGGCGACAACAAT
    miRferno
    ZAC; ARF GTPase activator/ phospholipid binding
    16
    gma-miR390d;gma-miR390b-5p
    5.5
    chr8:9532127-9532147
    +
    GGTGCTATGCCTCCAGACTGT
    CCACGATAGGGAGGACTCGAA
    miRferno
    ZAC; ARF GTPase activator/ phospholipid binding
    17
    gma-miR396j
    4.5
    chr8:9532208-9532228
    +
    TGTTCCTCAGCAATTTGGAAT
    AAAAGGTGTCGATAGAACTTA
    miRferno
    ZAC; ARF GTPase activator/ phospholipid binding
    18
    gma-miR482c-3p
    5
    chr19:29966644-29966664
    +
    AGTAATAGGGTGAATTGAGAA
    TCCTTACCCGCCTTAACCCTT
    miRferno
    hydrolase
    19
    gma-miR171i-5p
    4.5
    chr7:229779-229798
    +
    TTTTTTCATTGTTTTCTTTT
    AAACTCGTAACGAAAGAATA
    miRferno
    ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase
    20
    gma-miR1514a-5p
    4.5
    chr7:225450-225470
    +
    AATGCCTGATGTAAAGATGGA
    TTACGGATAAAATTTTTACTT
    miRferno
    ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase
    21
    gma-miR396g
    5.0
    chr7:225042-225062
    +
    GAGGGATAGGAAGTTCAGTAA
    CTACGTATTCTTCAAGTTCTT
    miRferno
    ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein tyrosine kinase
    22
    gma-miR2606a;gma-miR2606b
    4.5
    chr2:6312909-6312929
    -
    TACTGTTCAAAAAGTGCTATT
    ATGGCAAGGAATTCACGAAAA
    miRferno
    shikimate kinase family protein
    23
    gma-miR1514a-5p
    4.5
    chr6:9602397-9602417
    +
    AGTTACCATTATAAAAATGAA
    TTACGGATAAAATTTTTACTT
    miRferno
    NDH-M (subunit NDH-M of NAD(P)H:plastoquinone dehydrogenase complex)
    24
    gma-miR9744
    5.5
    chr6:9601761-9601781
    +
    TCTATGCAGCGTATATCGATC
    ACATACGTCGAGTATAGGTAA
    miRferno
    NDH-M (subunit NDH-M of NAD(P)H:plastoquinone dehydrogenase complex)
    25
    gma-miR9747
    3.5
    chr2:44497612-44497633
    -
    AAAGTATTTAATTCAGAGTATG
    TTTCATAAATTTAGTAGCGTAC
    miRferno
    FAD8 (FATTY ACID DESATURASE 8); omega-3 fatty acid desaturase
    26
    gma-miR1514a-5p
    4.5
    chr2:44497788-44497808
    -
    AATTCTTTTTTTAAAAAAAAA
    TTACGGATAAAATTTTTACTT
    miRferno
    FAD8 (FATTY ACID DESATURASE 8); omega-3 fatty acid desaturase
    27
    gma-miR5371-3p
    4.5
    chr15:680165-680185
    -
    TCTATAAATTAATTAATGAAA
    AGATCTTTAATCAGTGACTCT
    miRferno
    PLDALPHA1 (PHOSPHOLIPASE D ALPHA 1); phospholipase D
    28
    gma-miR408b-3p;gma-miR408a-3p;gma-miR408c-3p
    5
    chr20:33015587-33015607
    +
    ACCAAGGAAGAGGGTGTACAT
    CGGTCCCTTCTCCGTCACGTA
    miRferno
    CRT1 (CALRETICULIN 1); calcium ion binding / unfolded protein binding
    29
    gma-miR9722
    4.0
    chr1:49782326-49782346
    -
    TACAGCTTCTTCTCTTTATTT
    AAGTAGAAGAAGGGAGATAAT
    miRferno
    FAH1 (FERULIC ACID 5-HYDROXYLASE 1); ferulate 5-hydroxylase/ monooxygenase
    30
    gma-miR167d;gma-miR167a;gma-miR167b
    4.5
    chr6:7956627-7956647
    +
    TACATCATGCGGAAAGTTTCA
    ATCTAGTACGACCGTCGAAGT
    miRferno
    unknown protein