Search By Other

 Search
 for  
 In 
       ?

Glycine max miRNA Target Genome sites

Total 377884 records in 12597 Pages. Current page: 8

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    gma-miR5370
    3.0
    chr8:43387514-43387534
    +
    TTTTTTTAGGACAATTTTTGG
    AAGGAAAACCTGTTAGAAATC
    miRferno
    SWIB complex BAF60b domain-containing protein
    2
    gma-miR1507c-5p
    5
    chr12:6212919-6212939
    +
    TTCTCTCACCCCCAAAACCAA
    AAGAGAGTAGGGTTTGTGGAG
    miRferno
    lactoylglutathione lyase, putative / glyoxalase I, putative
    3
    gma-miR1520e
    5.5
    chr1:320748-320771
    +
    CTTTCACATTTCACATTTTTATTC
    GACAGTATACAGTGCAAGAATAAC
    miRferno
    HKT1 (HIGH-AFFINITY K+ TRANSPORTER 1); sodium ion transmembrane transporter
    4
    gma-miR162a
    5.5
    chr17:7252594-7252613
    -
    TGGATACAGAGGGCTATTTA
    ACCTACGTCTCCAAATAGCT
    miRferno
    PEX14; protein binding / protein transporter
    5
    gma-miR4349
    5
    chr17:7257115-7257138
    -
    TCTTTGTCTTTTCTCACACCATTA
    AGAAACAGAATAGAGATCGGTTAT
    miRferno
    PEX14; protein binding / protein transporter
    6
    gma-miR172k
    5
    chr4:39816384-39816404
    +
    AAGAATCAAGATCAAGATTCA
    TACGTCGTAGTAGTTCTAAGT
    miRferno
    GS2 (GLUTAMINE SYNTHETASE 2); glutamate-ammonia ligase
    7
    gma-miR5038a;gma-miR5038b
    4.0
    chr11:3964873-3964893
    +
    TGGGCAAATGCCAAACTCTTA
    ACCTGTCTCCGGTTTAAGAGT
    miRferno
    ATRER1A
    8
    gma-miR396c;gma-miR396b-5p;gma-miR396k-5p
    4.0
    chr11:3964922-3964942
    +
    AATTTTAAGAAACCTGTGCAG
    TTCAAGTTCTTTCGACACCTT
    miRferno
    ATRER1A
    9
    gma-miR5670b
    4.5
    chr8:22695351-22695372
    -
    GAAGAAAAAAGGGTATGGTGTT
    CTTCGTTTATACCATACTACAC
    miRferno
    pentatricopeptide (PPR) repeat-containing protein
    10
    gma-miR5670a
    3.5
    chr8:22695353-22695374
    -
    ATGAAGAAAAAAGGGTATGGTG
    TACTTCGTTTATACCATACTAC
    miRferno
    pentatricopeptide (PPR) repeat-containing protein
    11
    gma-miR171i-5p
    5
    chr3:41887631-41887650
    +
    ATTTACCATTGCTTTCTAAC
    AAACTCGTAACGAAAGAATA
    miRferno
    UGT73C1 (UDP-GLUCOSYL TRANSFERASE 73C1); UDP-glucosyltransferase/ UDP-glycosyltransferase/ cis-zeatin O-beta-D-glucosyltransferase/ trans-zeatin O-beta-D-glucosyltransferase/ transferase, transferring glycosyl groups
    12
    gma-miR171i-5p
    5
    chr14:29537234-29537253
    +
    TTTGAGGATTTCATGCTTTT
    AAACTCGTAACGAAAGAATA
    miRferno
    PI (PISTILLATA); DNA binding / transcription factor
    13
    gma-miR5775
    4.5
    chr13:8341442-8341462
    +
    GAAGCCCCAAAAACAGCTTGT
    CTTCGAGAGTTTTCTCGAATA
    miRferno
    protein phosphatase 2C, putative / PP2C, putative
    14
    gma-miR1520p
    4
    chr13:8336693-8336716
    +
    ACCGCCATCCGCCATTAACAACAT
    TGGCAGTAGTAGGTTATTGTTGTA
    miRferno
    protein phosphatase 2C, putative / PP2C, putative
    15
    gma-miR9735
    6.5
    chr13:8333823-8333846
    +
    CTTGAAAGTTGAAATTAAGGAGTT
    GAGGTTTCAACTTGAATTCGGCAT
    miRferno
    protein phosphatase 2C, putative / PP2C, putative
    16
    gma-miR5038a;gma-miR5038b
    5
    chr13:8334409-8334429
    +
    TTGACAGATGCCAAATTGGCT
    ACCTGTCTCCGGTTTAAGAGT
    miRferno
    protein phosphatase 2C, putative / PP2C, putative
    17
    gma-miR9722
    5.0
    chr13:8334869-8334889
    +
    TTCATTTTATTGTCACTATTA
    AAGTAGAAGAAGGGAGATAAT
    miRferno
    protein phosphatase 2C, putative / PP2C, putative
    18
    gma-miR1514a-5p
    4.5
    chr13:8334967-8334987
    +
    AATTTCTTTTTTTAAAATGAA
    TTACGGATAAAATTTTTACTT
    miRferno
    protein phosphatase 2C, putative / PP2C, putative
    19
    gma-miR5370
    5
    chr13:8333255-8333275
    +
    TTCCTTTTGGAGATGCTTTTT
    AAGGAAAACCTGTTAGAAATC
    miRferno
    protein phosphatase 2C, putative / PP2C, putative
    20
    gma-miR1520p
    6.5
    chr9:45023029-45023052
    +
    ACACTCATCATCCAATCCCAACGA
    TGGCAGTAGTAGGTTATTGTTGTA
    miRferno
    PEX11C (PEROXIN 11C)
    21
    gma-miR9722
    4.5
    chr20:44703685-44703705
    +
    CTTATGTTCTCCCCTATATTA
    AAGTAGAAGAAGGGAGATAAT
    miRferno
    unknown protein
    22
    gma-miR396j
    5.5
    chr20:44701371-44701391
    +
    TTTTCCACCCTTAACTTTAAT
    AAAAGGTGTCGATAGAACTTA
    miRferno
    unknown protein
    23
    gma-miR171i-5p
    4
    chr9:36045334-36045353
    -
    TGTGATCTTTGCTTTCTTCT
    AAACTCGTAACGAAAGAATA
    miRferno
    unknown protein
    24
    gma-miR1520f-3p
    5
    chr9:36050275-36050298
    -
    TTGTCATGTCTCATGCTGTTCTTG
    AACAGTACACAGTACAAGACTAAC
    miRferno
    unknown protein
    25
    gma-miR9726
    4.5
    chr6:3600468-3600489
    +
    AAAGAAGAAAATAAGGCCAAGA
    CTTCTTTTTTTATTACGGATAT
    miRferno
    CW7
    26
    gma-miR9766
    4.0
    chr4:1794333-1794353
    -
    GGTTCATTTCTTTCATTCAAT
    CAAAGTAAGGAAGGGAAGTTT
    miRferno
    ROP1 (RHO-RELATED PROTEIN FROM PLANTS 1); GTP binding / GTPase activating protein binding / GTPase/ protein binding
    27
    gma-miR1514a-5p
    4.5
    chr4:1793772-1793792
    -
    AATGCTTATTGCAGAAATAAA
    TTACGGATAAAATTTTTACTT
    miRferno
    ROP1 (RHO-RELATED PROTEIN FROM PLANTS 1); GTP binding / GTPase activating protein binding / GTPase/ protein binding
    28
    gma-miR2606a;gma-miR2606b
    4.5
    chr7:1561695-1561715
    +
    TACTGTTCCAGAAGAGCTATT
    ATGGCAAGGAATTCACGAAAA
    miRferno
    oxidoreductase family protein
    29
    gma-miR171k-3p
    5.0
    chr7:1560209-1560229
    +
    ATTGATGCTGGCGCTGCTCAG
    TCACTATAACCGCGCCGAGTT
    miRferno
    oxidoreductase family protein
    30
    gma-miR156b
    5
    chr7:1561089-1561109
    +
    TATGATCCCTCTCCTCTGTCT
    ACACGAGAGAGAGAAGACAGT
    miRferno
    oxidoreductase family protein