Search By Other

 Search
 for  
 In 
       ?

Glycine max miRNA Target Genome sites

Total 377884 records in 12597 Pages. Current page: 9

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    gma-miR156aa;gma-miR156z
    4.5
    chr6:45919759-45919776
    -
    AGGTGCTGTCACTCCAAT
    TCGAGGGAAGTGAGGTTA
    miRferno
    cysteine proteinase, putative
    2
    gma-miR394a-3p
    4.0
    chr13:37199105-37199124
    +
    TGAGTGCAGCCAGCAGAGCT
    TTTCACATCGGTTGTCTCGA
    miRferno
    wound-responsive protein, putative
    3
    gma-miR5380c
    5.5
    chr13:37333075-37333095
    -
    CCTTTCATTTTCAATATTCAT
    GAGAAGTAGAAGTGGTAAGTA
    miRferno
    RD22; nutrient reservoir
    4
    gma-miR171i-5p
    4.5
    chr3:40505352-40505371
    +
    TTTAAGCATTTGTTTTTTTT
    AAACTCGTAACGAAAGAATA
    miRferno
    CLASP (CLIP-ASSOCIATED PROTEIN); binding
    5
    gma-miR162a
    5
    chr3:40493111-40493130
    +
    TGGATTCATAGGACTATCAA
    ACCTACGTCTCCAAATAGCT
    miRferno
    CLASP (CLIP-ASSOCIATED PROTEIN); binding
    6
    gma-miR4995
    4.5
    chr3:40490928-40490948
    +
    CCGTCAATCTAGCCACTCCCT
    GGGAATTGGTTCGGTGACGGA
    miRferno
    CLASP (CLIP-ASSOCIATED PROTEIN); binding
    7
    gma-miR1514a-5p
    4
    chr3:40498504-40498524
    +
    AATACCTATTGTAAAAATGTT
    TTACGGATAAAATTTTTACTT
    miRferno
    CLASP (CLIP-ASSOCIATED PROTEIN); binding
    8
    gma-miR5371-3p
    4.5
    chr19:42723703-42723723
    +
    TCTAGGAACTAGGGACGGAGA
    AGATCTTTAATCAGTGACTCT
    miRferno
    unknown protein
    9
    gma-miR4374a
    4.5
    chr1:53166286-53166307
    +
    GGCTGACATCACGATCGGGTTT
    ACGACTGTAGTGCTGGCAGAAT
    miRferno
    matrix metalloproteinase, putative
    10
    gma-miR167e;gma-miR167f
    5.0
    chr4:47133052-47133072
    -
    AATGTTATGCTGGCATCTTAA
    TTCTAGTACGACCGTCGAAGT
    miRferno
    PTAC7
    11
    gma-miR1514a-5p
    5
    chr4:47132324-47132344
    -
    AATACATATTTTTAACATTAA
    TTACGGATAAAATTTTTACTT
    miRferno
    PTAC7
    12
    gma-miR9744
    5
    chr4:47132955-47132975
    -
    TGTATGCAAATCAAAGCCATC
    ACATACGTCGAGTATAGGTAA
    miRferno
    PTAC7
    13
    gma-miR4996
    5.5
    chr14:42618850-42618869
    -
    GTGAACATGATCAGCTTCTT
    CTCTTGTACCCCTCGAAGAT
    miRferno
    unknown protein
    14
    gma-miR1510b-3p
    5
    chr8:5707008-5707028
    +
    TGAGGAAGAGGTTAAACAAGA
    CCACCTTATCCATTTTGTTGT
    miRferno
    NLP1 (NITRILASE-LIKE PROTEIN 1); N-carbamoylputrescine amidase/ hydrolase, acting on carbon-nitrogen (but not peptide) bonds
    15
    gma-miR5037b
    6.0
    chr8:5708373-5708392
    +
    TCAGGAACTCTTTGAAGGTT
    GATCCTTCGGAAACTCCCAA
    miRferno
    NLP1 (NITRILASE-LIKE PROTEIN 1); N-carbamoylputrescine amidase/ hydrolase, acting on carbon-nitrogen (but not peptide) bonds
    16
    gma-miR4415a-5p
    4.5
    chr8:5709441-5709461
    +
    CATTGACTCTCGTGACCACTG
    GTAACTAAGAGTAGTGTTGAA
    miRferno
    NLP1 (NITRILASE-LIKE PROTEIN 1); N-carbamoylputrescine amidase/ hydrolase, acting on carbon-nitrogen (but not peptide) bonds
    17
    gma-miR156e;gma-miR156d;gma-miR156c;gma-miR156m;gm
    4.0
    chr13:29535880-29535900
    -
    CTCCTTTTTTTCTTCTGTCAA
    CACGAGAGATAGAAGACAGTT
    miRferno
    signal peptidase I family protein
    18
    gma-miR1507c-5p
    5.5
    chr13:29537097-29537117
    -
    TTCTCTCATCCGGAACGTGTC
    AAGAGAGTAGGGTTTGTGGAG
    miRferno
    signal peptidase I family protein
    19
    gma-miR9747
    4.0
    chr9:37940963-37940984
    -
    AAAGTGTTTAAATAATTGAATA
    TTTCATAAATTTAGTAGCGTAC
    miRferno
    zinc finger (C3HC4-type RING finger) family protein
    20
    gma-miR172k
    5.5
    chr9:37940724-37940744
    -
    ATGCAATATAAGCAATATTCA
    TACGTCGTAGTAGTTCTAAGT
    miRferno
    zinc finger (C3HC4-type RING finger) family protein
    21
    gma-miR408b-3p;gma-miR408a-3p;gma-miR408c-3p
    6.0
    chr10:7109242-7109262
    -
    GCCAGGGAAGAGTTACTTTAT
    CGGTCCCTTCTCCGTCACGTA
    miRferno
    PAP22 (PURPLE ACID PHOSPHATASE 22); acid phosphatase/ protein serine/threonine phosphatase
    22
    gma-miR390e
    5
    chr4:7318442-7318461
    +
    GGAACACTCCCTCCAGAGCT
    CCGCGATAGGGAGGACTCGA
    miRferno
    leucine-rich repeat family protein / protein kinase family protein
    23
    gma-miR390d;gma-miR390b-5p
    4.5
    chr4:7319084-7319104
    +
    GGTGAAATCCCACCTCAGTTT
    CCACGATAGGGAGGACTCGAA
    miRferno
    leucine-rich repeat family protein / protein kinase family protein
    24
    gma-miR1523b
    4.5
    chr15:1059819-1059838
    -
    GTTGAGGTCACGAGCGATGG
    ACACTCGAGTCCTCGCTACT
    miRferno
    DNA repair protein, putative (XRCC1)
    25
    gma-miR9744
    4.5
    chr15:1059318-1059338
    -
    TGTTTGAAGATTATATGCATT
    ACATACGTCGAGTATAGGTAA
    miRferno
    DNA repair protein, putative (XRCC1)
    26
    gma-miR171i-3p
    4.5
    chr12:38208457-38208477
    -
    AGAGAGATTAGCACGGTTCAA
    GCACTATAACCGTGCCGAGTT
    miRferno
    unknown protein
    27
    gma-miR171c-3p;gma-miR171o-3p;gma-miR171q
    4.5
    chr12:38208457-38208477
    -
    AGAGAGATTAGCACGGTTCAA
    ACACTATAACCGTGCCGAGTT
    miRferno
    unknown protein
    28
    gma-miR9760
    3.5
    chr3:27659978-27659998
    -
    CAATGAGAATTTCATCATCCG
    GTTAGTTTTGATGTAGTAGGT
    miRferno
    basic helix-loop-helix (bHLH) family protein
    29
    gma-miR171i-5p
    4
    chr20:34689584-34689603
    +
    TTTTTGCTTTGCTTTATTAT
    AAACTCGTAACGAAAGAATA
    miRferno
    JAG (JAGGED); nucleic acid binding / transcription factor/ zinc ion binding
    30
    gma-miR5380c
    4.0
    chr20:34689760-34689780
    +
    TTCTTCTTGTTCAACATTTAT
    GAGAAGTAGAAGTGGTAAGTA
    miRferno
    JAG (JAGGED); nucleic acid binding / transcription factor/ zinc ion binding