Search By Other

 Search
 for  
 In 
       ?

Oryza sativa miRNA Target Genome sites

Total 45101 records in 1504 Pages. Current page: 1
1/1504 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    osa-miR2096-3p
    4.5
    chr12:4760582-4760602
    -
    TCCTGCCGCTTCCGCCTCCGG
    AGGGCGGCTAAAGGGGAGTCC
    miRferno
    molecular_function,biological_process,molecular_function,biological_process
    2
    osa-miR393a
    4.5
    chr12:4750108-4750128
    -
    GATGAATGTGACACCTTCGGA
    CTAGTTACGCTAGGGAAACCT
    miRferno
    molecular_function,biological_process,molecular_function,biological_process
    3
    osa-miR393b-5p
    4.5
    chr12:4750108-4750129
    -
    AGATGAATGTGACACCTTCGGA
    TCTAGTTACGCTAGGGAAACCT
    miRferno
    molecular_function,biological_process,molecular_function,biological_process
    4
    osa-miR1850.3
    4
    chr12:4748931-4748952
    -
    AATTTTTATGTGAACTAAACAC
    TTCTAACTACACTTGATTTGTC
    miRferno
    molecular_function,biological_process,molecular_function,biological_process
    5
    osa-miR1858a;osa-miR1858b
    4.5
    chr03:24276656-24276676
    -
    TACCCACTCTGTGCTCCTCTG
    CGGGGTGAGGCAGGAGGAGAG
    miRferno
    signal transduction,lipid binding,cellular_component,response to endogenous stimulus,signal transduction,multicellular organismal development,lipid binding,biological_process
    6
    osa-miR827
    3.5
    chr03:24272893-24272913
    -
    TGATTGTTGATGATCATGTAA
    ACAAACGACTACCAGTAGATT
    miRferno
    signal transduction,lipid binding,cellular_component,response to endogenous stimulus,signal transduction,multicellular organismal development,lipid binding,biological_process
    7
    osa-miR529a
    4
    chr03:24273244-24273263
    -
    GAAGAAGAAAGAGGAGACAC
    CTTCTTCTCTCTCCCATGTC
    miRferno
    signal transduction,lipid binding,cellular_component,response to endogenous stimulus,signal transduction,multicellular organismal development,lipid binding,biological_process
    8
    osa-miR5793
    4.5
    chr03:24277011-24277031
    -
    ATGATCTGTGTCTCGTCCTCT
    GACGTGACATAGAGCAGGAGC
    miRferno
    signal transduction,lipid binding,cellular_component,response to endogenous stimulus,signal transduction,multicellular organismal development,lipid binding,biological_process
    9
    osa-miR816
    4
    chr03:24275799-24275818
    -
    GTTGTTGTAAAATATAACAG
    CAACATCATTTTATACAGTG
    miRferno
    signal transduction,lipid binding,cellular_component,response to endogenous stimulus,signal transduction,multicellular organismal development,lipid binding,biological_process
    10
    osa-miR1320-3p
    5
    chr03:24274603-24274623
    -
    TTGGAAGGAATCTTTCTTACA
    AACCTTGCTTACTTAAAATGT
    miRferno
    signal transduction,lipid binding,cellular_component,response to endogenous stimulus,signal transduction,multicellular organismal development,lipid binding,biological_process
    11
    osa-miR171g
    4
    chr01:34388733-34388753
    +
    GATATGGGCTCTGCTCTCATC
    CTATAACCGAGCCGAGTGGAG
    miRferno
    protein metabolic process,catabolic process,cellular process,binding,intracellular,hydrolase activity
    12
    osa-miR1436
    1.5
    chr11:25544814-25544834
    +
    ATTCCCTCCGTCCCATAATAT
    TGAGGGAGGCAGGGTATTACA
    miRferno
    metabolic process,cellular process,nucleus,nucleotide binding,kinase activity,protein modification process,cytoplasm,protein binding
    13
    osa-miR2102-5p
    5
    chr07:1500681-1500700
    +
    GCGGCGGCGGCGGCGTGGAA
    CACCGCCGCCGCCGAACGGG
    miRferno
    molecular_function,extracellular region,biological_process
    14
    osa-miR418
    4.5
    chr06:28622519-28622539
    +
    AGTCCTCACATCATCATATTA
    GCAGTAAAGTAGTAGTGTAAT
    miRferno
    membrane,plastid,thylakoid,protein metabolic process,hydrolase activity
    15
    osa-miR171c-3p;osa-miR171b;osa-miR171e-3p;osa-miR1
    4.5
    chr06:28626397-28626417
    +
    AATAATGGCAAGGCTTAACCA
    CTATAACCGTGCCGAGTTAGT
    miRferno
    membrane,plastid,thylakoid,protein metabolic process,hydrolase activity
    16
    osa-miR2102-5p
    4.5
    chr06:28621150-28621169
    +
    GCCGCGGCGGCGGCCTTCTC
    CACCGCCGCCGCCGAACGGG
    miRferno
    membrane,plastid,thylakoid,protein metabolic process,hydrolase activity
    17
    osa-miR5157b-3p;osa-miR5157a-3p
    5.0
    chr02:20885980-20886003
    +
    TTCTTATTGCTAGCCATAACTTTT
    TTGAAAAACTATCGGTGTTGAAGA
    miRferno
    biological_process,binding
    18
    osa-miR529a
    4.0
    chr02:20883073-20883092
    +
    TAACAGGGGAGAGGGTAAAG
    CTTCTTCTCTCTCCCATGTC
    miRferno
    biological_process,binding
    19
    osa-miR1436
    4.5
    chr02:20883494-20883514
    +
    ACCCCCTCCGTTCCAAAAAGA
    TGAGGGAGGCAGGGTATTACA
    miRferno
    biological_process,binding
    20
    osa-miR2102-5p
    5
    chr02:20884384-20884403
    +
    TCGGCGGCGGCGGCGAGCCG
    CACCGCCGCCGCCGAACGGG
    miRferno
    biological_process,binding
    21
    osa-miR2878-3p
    5.0
    chr02:10004299-10004322
    +
    ATTCTTGATAAGTTTAAAATCTTT
    TAAGAAATGTACATATTTTAGGAC
    miRferno
    metabolic process,cellular_component,post-embryonic development,peroxisome,flower development,catabolic process,cellular process,lipid metabolic process,cell wall,multicellular organismal development,biosynthetic process,catalytic activity,plastid
    22
    osa-miR2093-3p
    5.5
    chr02:10008928-10008947
    +
    ATGCATTCGTGTGAAGCTGT
    TACGTAATTAACCTTCTACA
    miRferno
    metabolic process,cellular_component,post-embryonic development,peroxisome,flower development,catabolic process,cellular process,lipid metabolic process,cell wall,multicellular organismal development,biosynthetic process,catalytic activity,plastid
    23
    osa-miR156k
    5.5
    chr02:10003719-10003739
    +
    TGTACTCTCTACCTTCTATCT
    ACACGAGAGAGAGAAGACAGT
    miRferno
    metabolic process,cellular_component,post-embryonic development,peroxisome,flower development,catabolic process,cellular process,lipid metabolic process,cell wall,multicellular organismal development,biosynthetic process,catalytic activity,plastid
    24
    osa-miR816
    4.5
    chr02:10007647-10007666
    +
    GTTGTAATGCAACATGTCAC
    CAACATCATTTTATACAGTG
    miRferno
    metabolic process,cellular_component,post-embryonic development,peroxisome,flower development,catabolic process,cellular process,lipid metabolic process,cell wall,multicellular organismal development,biosynthetic process,catalytic activity,plastid
    25
    osa-miR1442
    3.5
    chr02:10010172-10010191
    +
    GCCCATCTACTACTATGAAC
    TGTGTAGATCATGATACTTA
    miRferno
    metabolic process,cellular_component,post-embryonic development,peroxisome,flower development,catabolic process,cellular process,lipid metabolic process,cell wall,multicellular organismal development,biosynthetic process,catalytic activity,plastid
    26
    osa-miR2095-5p
    5
    chr01:40134759-40134780
    +
    CTCTTGATGGTAAAATTATCTA
    GATAAGTAGCATTTTAATAGTC
    miRferno
    metabolic process,hydrolase activity,catalytic activity,plastid
    27
    osa-miR5819
    5
    chr01:40133165-40133185
    +
    CGCCGCGCTACCCCTCCGCCT
    GCGGCGGCAAGGGGAGCAGGA
    miRferno
    metabolic process,hydrolase activity,catalytic activity,plastid
    28
    osa-miR1848
    4.5
    chr03:30610073-30610093
    -
    AGCGCGCGCGCGCCGCGGTGG
    ACGTGCGCGCGCGGCCGCTCC
    miRferno
    metabolic process,transferase activity,lipid metabolic process
    29
    osa-miR1848
    5
    chr03:30611244-30611264
    -
    GTCACGCGCGCCGCCGCGAGG
    ACGTGCGCGCGCGGCCGCTCC
    miRferno
    metabolic process,transferase activity,lipid metabolic process
    30
    osa-miR1848
    5
    chr01:29479275-29479295
    +
    TGGCCGCGAGCTCCGGCGACG
    ACGTGCGCGCGCGGCCGCTCC
    miRferno
    cellular_component,metabolic process,hydrolase activity,cellular process,biological_process,cellular_component,metabolic process,hydrolase activity,cellular process,biological_process