Search By Other

 Search
 for  
 In 
       ?

Oryza sativa miRNA Target Genome sites

Total 45101 records in 1504 Pages. Current page: 1
1/1504 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1
osa-miR2096-3p
4.5
chr12:4760582-4760602
-
TCCTGCCGCTTCCGCCTCCGG
AGGGCGGCTAAAGGGGAGTCC
miRferno
molecular_function,biological_process,molecular_function,biological_process
2
osa-miR393a
4.5
chr12:4750108-4750128
-
GATGAATGTGACACCTTCGGA
CTAGTTACGCTAGGGAAACCT
miRferno
molecular_function,biological_process,molecular_function,biological_process
3
osa-miR393b-5p
4.5
chr12:4750108-4750129
-
AGATGAATGTGACACCTTCGGA
TCTAGTTACGCTAGGGAAACCT
miRferno
molecular_function,biological_process,molecular_function,biological_process
4
osa-miR1850.3
4
chr12:4748931-4748952
-
AATTTTTATGTGAACTAAACAC
TTCTAACTACACTTGATTTGTC
miRferno
molecular_function,biological_process,molecular_function,biological_process
5
osa-miR1858a;osa-miR1858b
4.5
chr03:24276656-24276676
-
TACCCACTCTGTGCTCCTCTG
CGGGGTGAGGCAGGAGGAGAG
miRferno
signal transduction,lipid binding,cellular_component,response to endogenous stimulus,signal transduction,multicellular organismal development,lipid binding,biological_process
6
osa-miR827
3.5
chr03:24272893-24272913
-
TGATTGTTGATGATCATGTAA
ACAAACGACTACCAGTAGATT
miRferno
signal transduction,lipid binding,cellular_component,response to endogenous stimulus,signal transduction,multicellular organismal development,lipid binding,biological_process
7
osa-miR529a
4
chr03:24273244-24273263
-
GAAGAAGAAAGAGGAGACAC
CTTCTTCTCTCTCCCATGTC
miRferno
signal transduction,lipid binding,cellular_component,response to endogenous stimulus,signal transduction,multicellular organismal development,lipid binding,biological_process
8
osa-miR5793
4.5
chr03:24277011-24277031
-
ATGATCTGTGTCTCGTCCTCT
GACGTGACATAGAGCAGGAGC
miRferno
signal transduction,lipid binding,cellular_component,response to endogenous stimulus,signal transduction,multicellular organismal development,lipid binding,biological_process
9
osa-miR816
4
chr03:24275799-24275818
-
GTTGTTGTAAAATATAACAG
CAACATCATTTTATACAGTG
miRferno
signal transduction,lipid binding,cellular_component,response to endogenous stimulus,signal transduction,multicellular organismal development,lipid binding,biological_process
10
osa-miR1320-3p
5
chr03:24274603-24274623
-
TTGGAAGGAATCTTTCTTACA
AACCTTGCTTACTTAAAATGT
miRferno
signal transduction,lipid binding,cellular_component,response to endogenous stimulus,signal transduction,multicellular organismal development,lipid binding,biological_process
11
osa-miR171g
4
chr01:34388733-34388753
+
GATATGGGCTCTGCTCTCATC
CTATAACCGAGCCGAGTGGAG
miRferno
protein metabolic process,catabolic process,cellular process,binding,intracellular,hydrolase activity
12
osa-miR1436
1.5
chr11:25544814-25544834
+
ATTCCCTCCGTCCCATAATAT
TGAGGGAGGCAGGGTATTACA
miRferno
metabolic process,cellular process,nucleus,nucleotide binding,kinase activity,protein modification process,cytoplasm,protein binding
13
osa-miR2102-5p
5
chr07:1500681-1500700
+
GCGGCGGCGGCGGCGTGGAA
CACCGCCGCCGCCGAACGGG
miRferno
molecular_function,extracellular region,biological_process
14
osa-miR418
4.5
chr06:28622519-28622539
+
AGTCCTCACATCATCATATTA
GCAGTAAAGTAGTAGTGTAAT
miRferno
membrane,plastid,thylakoid,protein metabolic process,hydrolase activity
15
osa-miR171c-3p;osa-miR171b;osa-miR171e-3p;osa-miR1
4.5
chr06:28626397-28626417
+
AATAATGGCAAGGCTTAACCA
CTATAACCGTGCCGAGTTAGT
miRferno
membrane,plastid,thylakoid,protein metabolic process,hydrolase activity
16
osa-miR2102-5p
4.5
chr06:28621150-28621169
+
GCCGCGGCGGCGGCCTTCTC
CACCGCCGCCGCCGAACGGG
miRferno
membrane,plastid,thylakoid,protein metabolic process,hydrolase activity
17
osa-miR5157b-3p;osa-miR5157a-3p
5.0
chr02:20885980-20886003
+
TTCTTATTGCTAGCCATAACTTTT
TTGAAAAACTATCGGTGTTGAAGA
miRferno
biological_process,binding
18
osa-miR529a
4.0
chr02:20883073-20883092
+
TAACAGGGGAGAGGGTAAAG
CTTCTTCTCTCTCCCATGTC
miRferno
biological_process,binding
19
osa-miR1436
4.5
chr02:20883494-20883514
+
ACCCCCTCCGTTCCAAAAAGA
TGAGGGAGGCAGGGTATTACA
miRferno
biological_process,binding
20
osa-miR2102-5p
5
chr02:20884384-20884403
+
TCGGCGGCGGCGGCGAGCCG
CACCGCCGCCGCCGAACGGG
miRferno
biological_process,binding
21
osa-miR2878-3p
5.0
chr02:10004299-10004322
+
ATTCTTGATAAGTTTAAAATCTTT
TAAGAAATGTACATATTTTAGGAC
miRferno
metabolic process,cellular_component,post-embryonic development,peroxisome,flower development,catabolic process,cellular process,lipid metabolic process,cell wall,multicellular organismal development,biosynthetic process,catalytic activity,plastid
22
osa-miR2093-3p
5.5
chr02:10008928-10008947
+
ATGCATTCGTGTGAAGCTGT
TACGTAATTAACCTTCTACA
miRferno
metabolic process,cellular_component,post-embryonic development,peroxisome,flower development,catabolic process,cellular process,lipid metabolic process,cell wall,multicellular organismal development,biosynthetic process,catalytic activity,plastid
23
osa-miR156k
5.5
chr02:10003719-10003739
+
TGTACTCTCTACCTTCTATCT
ACACGAGAGAGAGAAGACAGT
miRferno
metabolic process,cellular_component,post-embryonic development,peroxisome,flower development,catabolic process,cellular process,lipid metabolic process,cell wall,multicellular organismal development,biosynthetic process,catalytic activity,plastid
24
osa-miR816
4.5
chr02:10007647-10007666
+
GTTGTAATGCAACATGTCAC
CAACATCATTTTATACAGTG
miRferno
metabolic process,cellular_component,post-embryonic development,peroxisome,flower development,catabolic process,cellular process,lipid metabolic process,cell wall,multicellular organismal development,biosynthetic process,catalytic activity,plastid
25
osa-miR1442
3.5
chr02:10010172-10010191
+
GCCCATCTACTACTATGAAC
TGTGTAGATCATGATACTTA
miRferno
metabolic process,cellular_component,post-embryonic development,peroxisome,flower development,catabolic process,cellular process,lipid metabolic process,cell wall,multicellular organismal development,biosynthetic process,catalytic activity,plastid
26
osa-miR2095-5p
5
chr01:40134759-40134780
+
CTCTTGATGGTAAAATTATCTA
GATAAGTAGCATTTTAATAGTC
miRferno
metabolic process,hydrolase activity,catalytic activity,plastid
27
osa-miR5819
5
chr01:40133165-40133185
+
CGCCGCGCTACCCCTCCGCCT
GCGGCGGCAAGGGGAGCAGGA
miRferno
metabolic process,hydrolase activity,catalytic activity,plastid
28
osa-miR1848
4.5
chr03:30610073-30610093
-
AGCGCGCGCGCGCCGCGGTGG
ACGTGCGCGCGCGGCCGCTCC
miRferno
metabolic process,transferase activity,lipid metabolic process
29
osa-miR1848
5
chr03:30611244-30611264
-
GTCACGCGCGCCGCCGCGAGG
ACGTGCGCGCGCGGCCGCTCC
miRferno
metabolic process,transferase activity,lipid metabolic process
30
osa-miR1848
5
chr01:29479275-29479295
+
TGGCCGCGAGCTCCGGCGACG
ACGTGCGCGCGCGGCCGCTCC
miRferno
cellular_component,metabolic process,hydrolase activity,cellular process,biological_process,cellular_component,metabolic process,hydrolase activity,cellular process,biological_process
IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1/1504 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>