Search By Other

 Search
 for  
 In 
       ?

Picea abies miRNA Target Genome sites

Total 4462 records in 149 Pages. Current page: 1
1/149 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    pab-miR3704
    5
    MA_10011980:1367-1388
    -
    CTTCTCCTTCTCCACCGAGACC
    AAAAAGGTTGAGGTGGATCTGG
    miRferno
    leucine-rich repeat extensin 3
    2
    pab-miR3693
    3.5
    MA_10013703:695-716
    -
    GAGAAGTCCATGAGCATCCTCA
    CTCGTCAAGTACTCGTGGGAGA
    miRferno
    disease resistance ADR1-like 1 [Arabidopsis thaliana]
    3
    pab-miR3711
    3.0
    MA_100211:4482-4501
    -
    GGGTCATCCTTCTGGCGTCA
    TCCGGGAGGAAGATCGCGGT
    miRferno
    metal transporter Nramp5-like
    4
    pab-miR950-5p
    2.5
    MA_10024934:2665-2686
    -
    AATCATCGTGGTCCGGATGTTA
    TTGGTAGCACCGGGTCTACACT
    miRferno
    TMV resistance N-like
    5
    pab-miR951
    2.5
    MA_10024934:2659-2680
    -
    CGTGGTCCGGATGTTAAAAACA
    GCACCAGGTCTGCAGTTCTTGT
    miRferno
    TMV resistance N-like
    6
    pab-miR3709b
    2.5
    MA_10025084:1824-1845
    -
    TCGGGAATTTGAGGCTCTTAAA
    AGCCCTTAAATTCCGTAAATTT
    miRferno
    disease resistance RGA3 [Morus notabilis]
    7
    pab-miR395
    2.5
    MA_100474:3631-3651
    +
    AAGTTCTTCTGAATGCTTCAG
    TTCAAGGAGGTTTGTGAAGTC
    miRferno
    cytochrome b5-like
    8
    pab-miR950-5p
    5
    MA_10048467:3848-3869
    +
    AACCATCTCCGCCCAAATGTAA
    TTGGTAGCACCGGGTCTACACT
    miRferno
    transcription repressor MYB5-like
    9
    pab-miR3709a
    5
    MA_10053307:4707-4727
    +
    TCAGGAATAAAAAGCATCCCA
    AGCCCTTAAATTTCGTAGACT
    miRferno
    ribosomal L1 domain-containing 1-like
    10
    pab-miR3705
    5.0
    MA_10055565:3074-3094
    -
    GTCGAGATCGAAACGACTTGC
    CAGGTCTAGTATTGGTGAATG
    miRferno
    unknown
    11
    pab-miR3706
    5
    MA_100606:46984-47003
    +
    TCTTCTCAATATCTCCGTAT
    AGAATAGGTAAAGAGGCTTT
    miRferno
    pentatricopeptide repeat-containing At5g16860 [Cucumis melo]
    12
    pab-miR3706
    4
    MA_100637:2151-2170
    +
    TCTAATCAATTTCTCATAAA
    AGAATAGGTAAAGAGGCTTT
    miRferno
    pentatricopeptide repeat-containing mitochondrial
    13
    pab-miR3711
    4.5
    MA_100776:39010-39029
    -
    AGCCACTCTTTCTAGCAACA
    TCCGGGAGGAAGATCGCGGT
    miRferno
    T-complex 1 subunit theta-like
    14
    pab-miR1863
    4.5
    MA_100776:39939-39960
    -
    ATTTCAACATGGTTTCAGAGCT
    TTAGATTGTACCATAGTCTCGA
    miRferno
    T-complex 1 subunit theta-like
    15
    pab-miR3705
    5.5
    MA_10090072:7659-7679
    +
    GACCAGATCAGAACCAGTTGG
    CAGGTCTAGTATTGGTGAATG
    miRferno
    pentatricopeptide repeat-containing At3g16610 [Nelumbo nucifera]
    16
    pab-miR396a
    5.5
    MA_100965:8746-8766
    -
    TCTTTCAAGAAGACTGTGGAT
    ATCAAGTTCTTTCGACACCTT
    miRferno
    unknown
    17
    pab-miR482c
    5.5
    MA_101003:11674-11695
    +
    GGAATAGGAGGAGGAGGAATAG
    CCTTACCCTCCTCATCCTTTCT
    miRferno
    ---NA---
    18
    pab-miR3706
    4.5
    MA_10101694:9287-9306
    +
    TCGTCTCCATTTCTGTGAAA
    AGAATAGGTAAAGAGGCTTT
    miRferno
    ribosomal S4
    19
    pab-miR396a
    4.5
    MA_101113:22168-22188
    +
    AAGTTCAAGATAACTCTGGAG
    ATCAAGTTCTTTCGACACCTT
    miRferno
    hydroxymethylglutaryl- synthase-like
    20
    pab-miR396c;pab-miR396b
    5.0
    MA_101113:22168-22188
    +
    AAGTTCAAGATAACTCTGGAG
    TTCAAGTTCTTTCGGCACCTT
    miRferno
    hydroxymethylglutaryl- synthase-like
    21
    pab-miR396a
    4
    MA_10113221:1241-1261
    -
    TATATGAAAAAAGCTGTGGAA
    ATCAAGTTCTTTCGACACCTT
    miRferno
    GEM 4
    22
    pab-miR3712
    4.0
    MA_10117498:1131-1152
    -
    TGATAGTCTGATATTAATTACG
    ACCATCAGACTAGAACTAGTGT
    miRferno
    TMV resistance N
    23
    pab-miR3711
    5.5
    MA_101231:5414-5433
    +
    ACGCCCTCCTTTAATGGCCA
    TCCGGGAGGAAGATCGCGGT
    miRferno
    probable manganese-transporting ATPase PDR2
    24
    pab-miR535
    5.0
    MA_10126:10420-10440
    +
    TCGTTTTCTCTCTTGTTGTCC
    CGCACGAGAGAGAGCAACAGT
    miRferno
    [Physcomitrella patens]
    25
    pab-miR3708
    4.5
    MA_101288:2824-2844
    -
    TGTATGAGAAATCTGGTTTTA
    ACATGCTCTTTACAACACACT
    miRferno
    epoxide partial [Pinus canariensis]
    26
    pab-miR3709a
    4.5
    MA_101290:12589-12609
    +
    TCTTTAATTTAAAGTATCTTA
    AGCCCTTAAATTTCGTAGACT
    miRferno
    NRT1 PTR FAMILY -like
    27
    pab-miR396c;pab-miR396b
    5.5
    MA_10132073:1731-1751
    +
    AACTGCAAGAAAGCCATGTGA
    TTCAAGTTCTTTCGGCACCTT
    miRferno
    EF hand family [Zea mays]
    28
    pab-miR3706
    5.5
    MA_10134:8839-8858
    +
    TCTTAATCTTTTCTCCAATA
    AGAATAGGTAAAGAGGCTTT
    miRferno
    50S ribosomal chloroplastic-like [Elaeis guineensis]
    29
    pab-miR3703
    5.5
    MA_10135775:3342-3362
    -
    GGCCAAGGCTGATAGAGCTAC
    CCTGTTCCGACTATCTCAGAT
    miRferno
    transcriptional regulator ATRX homolog [Nicotiana sylvestris]
    30
    pab-miR395
    5
    MA_101371:20966-20986
    -
    CAATTCCTCCAAACACTACTA
    TTCAAGGAGGTTTGTGAAGTC
    miRferno
    peptidyl-prolyl cis-trans isomerase FKBP62-like isoform X1