Search By Other

 Search
 for  
 In 
       ?

Picea abies miRNA Target Genome sites

Total 4462 records in 149 Pages. Current page: 1
1/149 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1
pab-miR3704
5
MA_10011980:1367-1388
-
CTTCTCCTTCTCCACCGAGACC
AAAAAGGTTGAGGTGGATCTGG
miRferno
leucine-rich repeat extensin 3
2
pab-miR3693
3.5
MA_10013703:695-716
-
GAGAAGTCCATGAGCATCCTCA
CTCGTCAAGTACTCGTGGGAGA
miRferno
disease resistance ADR1-like 1 [Arabidopsis thaliana]
3
pab-miR3711
3.0
MA_100211:4482-4501
-
GGGTCATCCTTCTGGCGTCA
TCCGGGAGGAAGATCGCGGT
miRferno
metal transporter Nramp5-like
4
pab-miR950-5p
2.5
MA_10024934:2665-2686
-
AATCATCGTGGTCCGGATGTTA
TTGGTAGCACCGGGTCTACACT
miRferno
TMV resistance N-like
5
pab-miR951
2.5
MA_10024934:2659-2680
-
CGTGGTCCGGATGTTAAAAACA
GCACCAGGTCTGCAGTTCTTGT
miRferno
TMV resistance N-like
6
pab-miR3709b
2.5
MA_10025084:1824-1845
-
TCGGGAATTTGAGGCTCTTAAA
AGCCCTTAAATTCCGTAAATTT
miRferno
disease resistance RGA3 [Morus notabilis]
7
pab-miR395
2.5
MA_100474:3631-3651
+
AAGTTCTTCTGAATGCTTCAG
TTCAAGGAGGTTTGTGAAGTC
miRferno
cytochrome b5-like
8
pab-miR950-5p
5
MA_10048467:3848-3869
+
AACCATCTCCGCCCAAATGTAA
TTGGTAGCACCGGGTCTACACT
miRferno
transcription repressor MYB5-like
9
pab-miR3709a
5
MA_10053307:4707-4727
+
TCAGGAATAAAAAGCATCCCA
AGCCCTTAAATTTCGTAGACT
miRferno
ribosomal L1 domain-containing 1-like
10
pab-miR3705
5.0
MA_10055565:3074-3094
-
GTCGAGATCGAAACGACTTGC
CAGGTCTAGTATTGGTGAATG
miRferno
unknown
11
pab-miR3706
5
MA_100606:46984-47003
+
TCTTCTCAATATCTCCGTAT
AGAATAGGTAAAGAGGCTTT
miRferno
pentatricopeptide repeat-containing At5g16860 [Cucumis melo]
12
pab-miR3706
4
MA_100637:2151-2170
+
TCTAATCAATTTCTCATAAA
AGAATAGGTAAAGAGGCTTT
miRferno
pentatricopeptide repeat-containing mitochondrial
13
pab-miR3711
4.5
MA_100776:39010-39029
-
AGCCACTCTTTCTAGCAACA
TCCGGGAGGAAGATCGCGGT
miRferno
T-complex 1 subunit theta-like
14
pab-miR1863
4.5
MA_100776:39939-39960
-
ATTTCAACATGGTTTCAGAGCT
TTAGATTGTACCATAGTCTCGA
miRferno
T-complex 1 subunit theta-like
15
pab-miR3705
5.5
MA_10090072:7659-7679
+
GACCAGATCAGAACCAGTTGG
CAGGTCTAGTATTGGTGAATG
miRferno
pentatricopeptide repeat-containing At3g16610 [Nelumbo nucifera]
16
pab-miR396a
5.5
MA_100965:8746-8766
-
TCTTTCAAGAAGACTGTGGAT
ATCAAGTTCTTTCGACACCTT
miRferno
unknown
17
pab-miR482c
5.5
MA_101003:11674-11695
+
GGAATAGGAGGAGGAGGAATAG
CCTTACCCTCCTCATCCTTTCT
miRferno
---NA---
18
pab-miR3706
4.5
MA_10101694:9287-9306
+
TCGTCTCCATTTCTGTGAAA
AGAATAGGTAAAGAGGCTTT
miRferno
ribosomal S4
19
pab-miR396a
4.5
MA_101113:22168-22188
+
AAGTTCAAGATAACTCTGGAG
ATCAAGTTCTTTCGACACCTT
miRferno
hydroxymethylglutaryl- synthase-like
20
pab-miR396c;pab-miR396b
5.0
MA_101113:22168-22188
+
AAGTTCAAGATAACTCTGGAG
TTCAAGTTCTTTCGGCACCTT
miRferno
hydroxymethylglutaryl- synthase-like
21
pab-miR396a
4
MA_10113221:1241-1261
-
TATATGAAAAAAGCTGTGGAA
ATCAAGTTCTTTCGACACCTT
miRferno
GEM 4
22
pab-miR3712
4.0
MA_10117498:1131-1152
-
TGATAGTCTGATATTAATTACG
ACCATCAGACTAGAACTAGTGT
miRferno
TMV resistance N
23
pab-miR3711
5.5
MA_101231:5414-5433
+
ACGCCCTCCTTTAATGGCCA
TCCGGGAGGAAGATCGCGGT
miRferno
probable manganese-transporting ATPase PDR2
24
pab-miR535
5.0
MA_10126:10420-10440
+
TCGTTTTCTCTCTTGTTGTCC
CGCACGAGAGAGAGCAACAGT
miRferno
[Physcomitrella patens]
25
pab-miR3708
4.5
MA_101288:2824-2844
-
TGTATGAGAAATCTGGTTTTA
ACATGCTCTTTACAACACACT
miRferno
epoxide partial [Pinus canariensis]
26
pab-miR3709a
4.5
MA_101290:12589-12609
+
TCTTTAATTTAAAGTATCTTA
AGCCCTTAAATTTCGTAGACT
miRferno
NRT1 PTR FAMILY -like
27
pab-miR396c;pab-miR396b
5.5
MA_10132073:1731-1751
+
AACTGCAAGAAAGCCATGTGA
TTCAAGTTCTTTCGGCACCTT
miRferno
EF hand family [Zea mays]
28
pab-miR3706
5.5
MA_10134:8839-8858
+
TCTTAATCTTTTCTCCAATA
AGAATAGGTAAAGAGGCTTT
miRferno
50S ribosomal chloroplastic-like [Elaeis guineensis]
29
pab-miR3703
5.5
MA_10135775:3342-3362
-
GGCCAAGGCTGATAGAGCTAC
CCTGTTCCGACTATCTCAGAT
miRferno
transcriptional regulator ATRX homolog [Nicotiana sylvestris]
30
pab-miR395
5
MA_101371:20966-20986
-
CAATTCCTCCAAACACTACTA
TTCAAGGAGGTTTGTGAAGTC
miRferno
peptidyl-prolyl cis-trans isomerase FKBP62-like isoform X1
IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1/149 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>