Search By Other

 Search
 for  
 In 
       ?

Picea abies miRNA Target Genome sites

Total 4462 records in 149 Pages. Current page: 11

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    pab-miR3702
    5
    MA_10429337:3711-3731
    +
    TCCAATTAGCAACAAGAGACT
    CGCTTATTCGTGGTTCTCTAA
    miRferno
    extensin-2-like [Musa acuminata malaccensis]
    2
    pab-miR1863
    4.0
    MA_10429400:12095-12116
    -
    ATTTTAACATGGTATCAGAGTG
    TTAGATTGTACCATAGTCTCGA
    miRferno
    methyltransferase 16 homolog isoform X2
    3
    pab-miR166b
    5
    MA_10429401:5622-5642
    +
    AAAACAAGAAGCCTGGCCCGA
    TTCCTTACTTCGGACCAGGCT
    miRferno
    glucan endo-1,3-beta-glucosidase 12
    4
    pab-miR396a
    5
    MA_10429431:22859-22879
    -
    AAGTACAATAAAGCTGTACAA
    ATCAAGTTCTTTCGACACCTT
    miRferno
    26S proteasome non-ATPase regulatory subunit 14 homolog
    5
    pab-miR396c;pab-miR396b
    4.5
    MA_10429431:22859-22879
    -
    AAGTACAATAAAGCTGTACAA
    TTCAAGTTCTTTCGGCACCTT
    miRferno
    26S proteasome non-ATPase regulatory subunit 14 homolog
    6
    pab-miR3707
    2.5
    MA_10429456:15889-15909
    +
    TGAAGGATAATGGTGGATTAT
    AGTTCCTATTACCGTCTAGTA
    miRferno
    threonine--tRNA mitochondrial
    7
    pab-miR482b
    5
    MA_10429456:19907-19928
    +
    GGAAGGAGAGGCACAGGGAATA
    CCTTACCCTCCTTATCCCTTCT
    miRferno
    threonine--tRNA mitochondrial
    8
    pab-miR3695
    5
    MA_10429478:3680-3700
    +
    CCCACAACCACAAGAGGACCA
    GGGTGTTGCTGGTCCGCTGTT
    miRferno
    Transcription factor bHLH14 [Theobroma cacao]
    9
    pab-miR3699
    3.5
    MA_10429494:17663-17683
    +
    GACCACAGCCTACCTTCTGTT
    CTGGTTTCAGATAGAAGACAG
    miRferno
    serine threonine- kinase D6PKL1-like [Sesamum indicum]
    10
    pab-miR3702
    5
    MA_10429511:3977-3997
    -
    GGGTATAAGCACCATGAATTT
    CGCTTATTCGTGGTTCTCTAA
    miRferno
    thaumatin partial [Picea sitchensis]
    11
    pab-miR3706
    5
    MA_10429532:10331-10350
    -
    TCTCATAGATCTCTCCAAAA
    AGAATAGGTAAAGAGGCTTT
    miRferno
    dol-P-Man:Man(6) c(2)-PP-Dol alpha-1,2-mannosyltransferase
    12
    pab-miR1863
    3.0
    MA_10429532:7484-7505
    -
    ATTTTTACATGGTATTAGAGCT
    TTAGATTGTACCATAGTCTCGA
    miRferno
    dol-P-Man:Man(6) c(2)-PP-Dol alpha-1,2-mannosyltransferase
    13
    pab-miR1863
    4.5
    MA_10429532:18980-19001
    -
    TTTTCAACATGGTATCAGAGCT
    TTAGATTGTACCATAGTCTCGA
    miRferno
    dol-P-Man:Man(6) c(2)-PP-Dol alpha-1,2-mannosyltransferase
    14
    pab-miR166b
    5.5
    MA_10429576:8049-8069
    -
    AAGGAAGGAGACCTAGTCCTA
    TTCCTTACTTCGGACCAGGCT
    miRferno
    vacuolar sorting-associated VTA1 homolog
    15
    pab-miR3709b
    5
    MA_10429626:3724-3745
    +
    TCACCAATTTAAGGCAACTAAA
    AGCCCTTAAATTCCGTAAATTT
    miRferno
    tropinone reductase homolog
    16
    pab-miR3711
    5.5
    MA_10429679:5781-5800
    +
    AGGGCATCATTCTAGCTTCA
    TCCGGGAGGAAGATCGCGGT
    miRferno
    wound-induced 1-like
    17
    pab-miR3709b
    5.5
    MA_10429691:10512-10533
    -
    ATGGGAATTTAAGTCATCAAAA
    AGCCCTTAAATTCCGTAAATTT
    miRferno
    Purple acid phosphatase 2
    18
    pab-miR3699
    4.5
    MA_10429691:9239-9259
    -
    GAAGAATGTTTATCTTCTGTA
    CTGGTTTCAGATAGAAGACAG
    miRferno
    Purple acid phosphatase 2
    19
    pab-miR3706
    5.5
    MA_10429720:4285-4304
    +
    TATTATCCATATCTCCAAGT
    AGAATAGGTAAAGAGGCTTT
    miRferno
    12-oxophytodienoate reductase 3-like
    20
    pab-miR396a
    5.5
    MA_10429751:4989-5009
    -
    TATTCCAAGATCGCTGTGTAA
    ATCAAGTTCTTTCGACACCTT
    miRferno
    Cf- [Solanum pimpinellifolium]
    21
    pab-miR3706
    5
    MA_10429819:18261-18280
    +
    CCTTATCCAATCCTACCAAA
    AGAATAGGTAAAGAGGCTTT
    miRferno
    ATP-dependent Clp protease proteolytic subunit-related chloroplastic
    22
    pab-miR396a
    5.5
    MA_10429865:8056-8076
    -
    TAGATCAAGATTGATGTGAAA
    ATCAAGTTCTTTCGACACCTT
    miRferno
    Nbs-lrr resistance isoform 1 [Theobroma cacao]
    23
    pab-miR3709b
    2
    MA_10429865:9034-9055
    -
    TCGGGAATTTAAAGCTTTTAAA
    AGCCCTTAAATTCCGTAAATTT
    miRferno
    Nbs-lrr resistance isoform 1 [Theobroma cacao]
    24
    pab-miR3709a
    2.5
    MA_10429865:9035-9055
    -
    TCGGGAATTTAAAGCTTTTAA
    AGCCCTTAAATTTCGTAGACT
    miRferno
    Nbs-lrr resistance isoform 1 [Theobroma cacao]
    25
    pab-miR535
    3.5
    MA_10429898:2601-2621
    -
    GCGAGCTCTTTCTGGTTATCA
    CGCACGAGAGAGAGCAACAGT
    miRferno
    GTP-binding [Ricinus communis]
    26
    pab-miR3699
    2.5
    MA_10429915:7557-7577
    -
    GACCAAGGTTTCTCTTTTGTC
    CTGGTTTCAGATAGAAGACAG
    miRferno
    S-adenosylmethionine carrier chloroplastic mitochondrial
    27
    pab-miR482c
    5
    MA_10429937:45480-45501
    -
    GTAATGTGAATAGTAGCAAAGA
    CCTTACCCTCCTCATCCTTTCT
    miRferno
    NC domain-containing family [Populus trichocarpa]
    28
    pab-miR482c
    4.5
    MA_10429937:45325-45346
    -
    GGAATAGGAGGAGGATGAATGG
    CCTTACCCTCCTCATCCTTTCT
    miRferno
    NC domain-containing family [Populus trichocarpa]
    29
    pab-miR3711
    5.5
    MA_10429952:4016-4035
    +
    AGGCACCCCTTCTAATCCCA
    TCCGGGAGGAAGATCGCGGT
    miRferno
    unknown
    30
    pab-miR1311
    5.5
    MA_10429987:3855-3876
    -
    GGCGGCACAGGAAAAACCTTGA
    CCGCCTTGACCGTTTTGAGACT
    miRferno
    ---NA---