Search By Other

 Search
 for  
 In 
       ?

Picea abies miRNA Target Genome sites

Total 4462 records in 149 Pages. Current page: 9

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    pab-miR3707
    4.5
    MA_10428218:27804-27824
    +
    TCAATTATTATGGCTGATTAT
    AGTTCCTATTACCGTCTAGTA
    miRferno
    poly(rC)-binding 1 [Phoenix dactylifera]
    2
    pab-miR1863
    3.5
    MA_10428271:23372-23393
    +
    AGTTTTACATGGTATTAGAGCC
    TTAGATTGTACCATAGTCTCGA
    miRferno
    ethylene-overproduction 1 [Nelumbo nucifera]
    3
    pab-miR3703
    5.5
    MA_10428271:31743-31763
    +
    GGACAAGGGTTATGCAGTCTT
    CCTGTTCCGACTATCTCAGAT
    miRferno
    ethylene-overproduction 1 [Nelumbo nucifera]
    4
    pab-miR3699
    3.5
    MA_10428291:28334-28354
    -
    GACGAAGGTATATCTTCTCTC
    CTGGTTTCAGATAGAAGACAG
    miRferno
    cryptochrome partial [Pinus sylvestris]
    5
    pab-miR3706
    3.5
    MA_10428335:24113-24132
    -
    TCTTTTCCATTTTTTTGATA
    AGAATAGGTAAAGAGGCTTT
    miRferno
    ---NA---
    6
    pab-miR947
    5
    MA_10428377:29824-29845
    +
    GAAAAAGTAACAGAATGCCACA
    CTTTGTCATTGTCTAAGGCTAT
    miRferno
    E3 ubiquitin- ligase UPL3-like
    7
    pab-miR3711
    4.0
    MA_10428403:10145-10164
    -
    AGGCCCTCCTTTTGTCGCCC
    TCCGGGAGGAAGATCGCGGT
    miRferno
    IAA-amino acid hydrolase ILR1-like 6
    8
    pab-miR3706
    5.5
    MA_10428420:19106-19125
    +
    TCTTATTCATTCTTTGGAAA
    AGAATAGGTAAAGAGGCTTT
    miRferno
    [Physcomitrella patens]
    9
    pab-miR396c;pab-miR396b
    5
    MA_10428420:15411-15431
    +
    AAACTCAAGAAAGCCTTGTAC
    TTCAAGTTCTTTCGGCACCTT
    miRferno
    [Physcomitrella patens]
    10
    pab-miR3706
    5.0
    MA_10428427:56402-56421
    +
    TCTTTTTCATTTCTTGAAAA
    AGAATAGGTAAAGAGGCTTT
    miRferno
    filament-like plant 7
    11
    pab-miR3706
    5.5
    MA_10428495:61310-61329
    +
    TCTTATGTATTTCTCCTTCA
    AGAATAGGTAAAGAGGCTTT
    miRferno
    oxysterol-binding -related 1C-like isoform X2
    12
    pab-miR3702
    5
    MA_10428495:33122-33142
    +
    TCAAACAAGAACCTAGAGATT
    CGCTTATTCGTGGTTCTCTAA
    miRferno
    oxysterol-binding -related 1C-like isoform X2
    13
    pab-miR396c;pab-miR396b
    5
    MA_10428495:12299-12319
    +
    AAGTGAAAGAAAGGCTTGGTA
    TTCAAGTTCTTTCGGCACCTT
    miRferno
    oxysterol-binding -related 1C-like isoform X2
    14
    pab-miR3707
    4.5
    MA_10428495:73000-73020
    +
    TCAAGGCTGAGGCCAGATCAA
    AGTTCCTATTACCGTCTAGTA
    miRferno
    oxysterol-binding -related 1C-like isoform X2
    15
    pab-miR3710
    3.5
    MA_10428495:18167-18187
    +
    TGGAGGCATGTGAGGTTCCCA
    ACCTCCGGGCAGTCCAAGGGT
    miRferno
    oxysterol-binding -related 1C-like isoform X2
    16
    pab-miR3712
    3.0
    MA_10428545:5395-5416
    -
    TGGTAGTCTCATTTTGCTTACA
    ACCATCAGACTAGAACTAGTGT
    miRferno
    TMV resistance N-like
    17
    pab-miR535
    5.5
    MA_10428551:28328-28348
    -
    ATCTGCTCTATCTAGTTGTCA
    CGCACGAGAGAGAGCAACAGT
    miRferno
    COBW domain-containing 1
    18
    pab-miR1863
    3.5
    MA_10428551:42336-42357
    -
    ATTCTAACATGGTATCAGAGTA
    TTAGATTGTACCATAGTCTCGA
    miRferno
    COBW domain-containing 1
    19
    pab-miR1863
    3.0
    MA_10428551:61531-61552
    -
    ATTCTGATATGGTATCAGAGCC
    TTAGATTGTACCATAGTCTCGA
    miRferno
    COBW domain-containing 1
    20
    pab-miR3707
    5
    MA_10428551:61454-61474
    -
    TCAAGGATCCTGGAAGTGCAT
    AGTTCCTATTACCGTCTAGTA
    miRferno
    COBW domain-containing 1
    21
    pab-miR3709a
    5
    MA_10428551:54421-54441
    -
    TAAGGACTATAAATCATCTGA
    AGCCCTTAAATTTCGTAGACT
    miRferno
    COBW domain-containing 1
    22
    pab-miR3706
    4.0
    MA_10428576:11472-11491
    +
    TCTTATCTACTTCTCTGCTA
    AGAATAGGTAAAGAGGCTTT
    miRferno
    VAC14 homolog
    23
    pab-miR3706
    5
    MA_10428635:37913-37932
    -
    TGTTATGGATCTCCCCGAAA
    AGAATAGGTAAAGAGGCTTT
    miRferno
    L-type lectin-domain containing receptor kinase -like
    24
    pab-miR3702
    5.5
    MA_10428646:7784-7804
    +
    GCCAATAAACTGAAAGAGATT
    CGCTTATTCGTGGTTCTCTAA
    miRferno
    PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein LOC18441740
    25
    pab-miR3709a
    5
    MA_10428646:5166-5186
    +
    TCAGGAATTTATAGCTCCTGT
    AGCCCTTAAATTTCGTAGACT
    miRferno
    PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein LOC18441740
    26
    pab-miR1863
    5
    MA_10428694:21053-21074
    +
    AATCCAACTTGATACCAGAGCA
    TTAGATTGTACCATAGTCTCGA
    miRferno
    serine hydroxymethyltransferase 7-like
    27
    pab-miR482d
    4.5
    MA_10428694:19439-19459
    +
    GTTTTCCCATCATTGCAAGGC
    AAAAAGGATAGGAGCGTTCGG
    miRferno
    serine hydroxymethyltransferase 7-like
    28
    pab-miR396c;pab-miR396b
    5
    MA_10428715:25492-25512
    -
    AAGAACAAGAAAGACGGGGCA
    TTCAAGTTCTTTCGGCACCTT
    miRferno
    26S protease regulatory subunit 7
    29
    pab-miR482a
    5
    MA_10428744:11431-11452
    +
    TGACAGGGAAGAGAAGGGAAGA
    CCTTACCCTCCTCATCCCTTCT
    miRferno
    CLK4-associating serine arginine rich isoform X2
    30
    pab-miR3709a
    3.5
    MA_10428745:4684-4704
    -
    TCGAAAATTTAGAGAATCTGA
    AGCCCTTAAATTTCGTAGACT
    miRferno
    disease resistance At1g50180