Search By Other

 Search
 for  
 In 
       ?

Bamboo miRNA Target Genome sites

Total 170965 records in 5699 Pages. Current page: 1
1/5699 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1
phe-miR169k
4.0
PH01000000:388059-388079
+
TCGGCATTGCATTTTTGGCTG
GGCCGTTCAGTAAGAACCGAC
miRferno
Os04g0584900 [Oryza sativa Japonica Group]
2
phe-miR156i-3p
5.5
PH01000000:1265604-1265627
-
CCGGATGCTTCCTTCTCTTTCTGG
GGCGCACGAGTGAAGAGAAAGACA
miRferno
carotenoid hydroxylase [Zea mays]
3
phe-miR171f-5p
5
PH01000000:1671699-1671719
-
AATGGAACCATCCCAAAATCA
CTAACTTGGTACGGTTGTAGC
miRferno
SPX domain-containing membrane _17046 [Brachypodium distachyon]
4
phe-miR396-3p
4
PH01000000:1672318-1672338
-
ATGCTCAAGTATGCTATGGAA
TTCGAGTTCTTTCGACACCTT
miRferno
SPX domain-containing membrane _17046 [Brachypodium distachyon]
5
phe-miR156f-5p
5.0
PH01000001:2830486-2830504
+
TTTTCCCTCTCTTCTTTTA
ACGAGTGAGAGAAGACAGT
miRferno
Regulator of nonsense transcripts 2 isoform 1 [Theobroma cacao]
6
phe-miR156b
5.0
PH01000001:2830485-2830504
+
ATTTTCCCTCTCTTCTTTTA
TACGAGTGAGAGAAGACAGT
miRferno
Regulator of nonsense transcripts 2 isoform 1 [Theobroma cacao]
7
phe-miR408-3p
4.5
PH01000002:159009-159029
+
GCCGTGGAAGAGGCCGAGCAT
CGGTCCCTTCTCCGTCACGTA
miRferno
leucine-rich repeat receptor kinase EXS
8
phe-miR390a-5p
5.5
PH01000002:155284-155304
+
GGTTCTATCCCTGCTGAGATA
CCGCGATAGGGAGGACTCGAA
miRferno
leucine-rich repeat receptor kinase EXS
9
phe-miR390a-5p
5
PH01000002:155074-155094
+
GGCTCTATCCCTGAAGAACTT
CCGCGATAGGGAGGACTCGAA
miRferno
leucine-rich repeat receptor kinase EXS
10
phe-miR390a-5p
4.5
PH01000002:157132-157152
+
GGTGCTATCCCAACTGAGATC
CCGCGATAGGGAGGACTCGAA
miRferno
leucine-rich repeat receptor kinase EXS
11
phe-miR390a-5p
4.5
PH01000002:156011-156031
+
GGCGCCATTCCTGCGGAGATT
CCGCGATAGGGAGGACTCGAA
miRferno
leucine-rich repeat receptor kinase EXS
12
phe-miR390a-5p
4.5
PH01000002:157288-157308
+
GGCGCCATTCCTGCGGAGATT
CCGCGATAGGGAGGACTCGAA
miRferno
leucine-rich repeat receptor kinase EXS
13
phe-miR390a-5p
4.5
PH01000002:155831-155851
+
GGTGCTATCCCAACTGAGATC
CCGCGATAGGGAGGACTCGAA
miRferno
leucine-rich repeat receptor kinase EXS
14
phe-miR390a-5p
5.5
PH01000002:156579-156599
+
GGTTCTATCCCTGCTGAGATA
CCGCGATAGGGAGGACTCGAA
miRferno
leucine-rich repeat receptor kinase EXS
15
phe-miR6198
4.5
PH01000002:151659-151680
+
AGAGTGCGCATGCAAGACAAAG
TCTTACTGGTAGGTTCTGTGTC
miRferno
leucine-rich repeat receptor kinase EXS
16
phe-miR3948
5.5
PH01000002:150852-150875
+
TCCTCCCACTCCCGCTGCTCACGT
ATGAGGGTGAGGGTGAGGTCTGGA
miRferno
leucine-rich repeat receptor kinase EXS
17
phe-miR528-5p
5.0
PH01000002:150712-150732
+
CTCCTCATCATGCCCCTCTCG
GAGGAGACGTACGGGGAAGGT
miRferno
leucine-rich repeat receptor kinase EXS
18
phe-miR166a-5p
4.5
PH01000002:402289-402309
+
CCTTGAAACAGAAAGCATGAC
GGAACTTGGTCTGTTGTAAGG
miRferno
---NA---
19
phe-miR408a-5p
4.5
PH01000002:401907-401927
+
AATACGCTGCCTTGGCCCCGA
GTACGCGACGGAGCAGGGACT
miRferno
---NA---
20
phe-miR395f
5
PH01000002:2691004-2691023
+
GAGTGGCCCCTAACAATCAA
CTCAAGGGGGTTTGTTAAGT
miRferno
Os01g0932600 [Oryza sativa Japonica Group]
21
phe-miR397-5p
5.5
PH01000003:110261-110279
-
CATCAAAGCTTCGATAAAT
GTAGTTGCGACGTGAGTTA
miRferno
Os08g0121800 [Oryza sativa Japonica Group]
22
phe-miR2876-3p
6.0
PH01000003:110082-110105
-
GATGGCAATATTGAGCATATATGA
CGACCGTTGTCACAAGTATATCCT
miRferno
Os08g0121800 [Oryza sativa Japonica Group]
23
phe-miR9780
4.5
PH01000003:1640693-1640711
+
CCGGGGAGCGCCGCCTCGA
CGCACGTCGCGGCTGGGCT
miRferno
CASP 1C1
24
phe-miR170-3p
5
PH01000003:2361853-2361873
-
ACAGATAATGAAACTGCACAA
TCTCTATAACTGTGCCGAGTT
miRferno
cold acclimation COR413-PM1 [Zea mays]
25
phe-miR2673a
5.0
PH01000003:2360424-2360442
-
CTCTTCATCTACCTTGTCT
GAGAAGGAGAAGGAGAAGG
miRferno
cold acclimation COR413-PM1 [Zea mays]
26
phe-miR5153
4.5
PH01000004:137528-137548
+
GTGAATTCGAGTGCCATGTAG
CACCTAAGGTGACTGTGCATC
miRferno
sister chromatid cohesion PDS5 homolog A
27
phe-miR159a.1
4.5
PH01000004:134387-134408
+
AAGCAGAGCAACCCTCAGTACA
TTCGTCTCGAGGGAAGTTAGGT
miRferno
sister chromatid cohesion PDS5 homolog A
28
phe-miR169y
5.5
PH01000004:1135933-1135953
+
CTAGCAAGTCTTCCTTCACCG
GGCCGTTCAGTAGGAAGCGAC
miRferno
alpha beta hydrolase domain-containing 11
29
phe-miR156f-5p
5.0
PH01000004:1135652-1135670
+
TGTTTTTTTTCTTCTGTCA
ACGAGTGAGAGAAGACAGT
miRferno
alpha beta hydrolase domain-containing 11
30
phe-miR2673a
5.5
PH01000004:1135940-1135958
+
GTCTTCCTTCACCGCTTCC
GAGAAGGAGAAGGAGAAGG
miRferno
alpha beta hydrolase domain-containing 11
IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1/5699 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>