Search By Other

 Search
 for  
 In 
       ?

Bamboo miRNA Target Genome sites

Total 170965 records in 5699 Pages. Current page: 1
1/5699 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    phe-miR169k
    4.0
    PH01000000:388059-388079
    +
    TCGGCATTGCATTTTTGGCTG
    GGCCGTTCAGTAAGAACCGAC
    miRferno
    Os04g0584900 [Oryza sativa Japonica Group]
    2
    phe-miR156i-3p
    5.5
    PH01000000:1265604-1265627
    -
    CCGGATGCTTCCTTCTCTTTCTGG
    GGCGCACGAGTGAAGAGAAAGACA
    miRferno
    carotenoid hydroxylase [Zea mays]
    3
    phe-miR171f-5p
    5
    PH01000000:1671699-1671719
    -
    AATGGAACCATCCCAAAATCA
    CTAACTTGGTACGGTTGTAGC
    miRferno
    SPX domain-containing membrane _17046 [Brachypodium distachyon]
    4
    phe-miR396-3p
    4
    PH01000000:1672318-1672338
    -
    ATGCTCAAGTATGCTATGGAA
    TTCGAGTTCTTTCGACACCTT
    miRferno
    SPX domain-containing membrane _17046 [Brachypodium distachyon]
    5
    phe-miR156f-5p
    5.0
    PH01000001:2830486-2830504
    +
    TTTTCCCTCTCTTCTTTTA
    ACGAGTGAGAGAAGACAGT
    miRferno
    Regulator of nonsense transcripts 2 isoform 1 [Theobroma cacao]
    6
    phe-miR156b
    5.0
    PH01000001:2830485-2830504
    +
    ATTTTCCCTCTCTTCTTTTA
    TACGAGTGAGAGAAGACAGT
    miRferno
    Regulator of nonsense transcripts 2 isoform 1 [Theobroma cacao]
    7
    phe-miR408-3p
    4.5
    PH01000002:159009-159029
    +
    GCCGTGGAAGAGGCCGAGCAT
    CGGTCCCTTCTCCGTCACGTA
    miRferno
    leucine-rich repeat receptor kinase EXS
    8
    phe-miR390a-5p
    5.5
    PH01000002:155284-155304
    +
    GGTTCTATCCCTGCTGAGATA
    CCGCGATAGGGAGGACTCGAA
    miRferno
    leucine-rich repeat receptor kinase EXS
    9
    phe-miR390a-5p
    5
    PH01000002:155074-155094
    +
    GGCTCTATCCCTGAAGAACTT
    CCGCGATAGGGAGGACTCGAA
    miRferno
    leucine-rich repeat receptor kinase EXS
    10
    phe-miR390a-5p
    4.5
    PH01000002:157132-157152
    +
    GGTGCTATCCCAACTGAGATC
    CCGCGATAGGGAGGACTCGAA
    miRferno
    leucine-rich repeat receptor kinase EXS
    11
    phe-miR390a-5p
    4.5
    PH01000002:156011-156031
    +
    GGCGCCATTCCTGCGGAGATT
    CCGCGATAGGGAGGACTCGAA
    miRferno
    leucine-rich repeat receptor kinase EXS
    12
    phe-miR390a-5p
    4.5
    PH01000002:157288-157308
    +
    GGCGCCATTCCTGCGGAGATT
    CCGCGATAGGGAGGACTCGAA
    miRferno
    leucine-rich repeat receptor kinase EXS
    13
    phe-miR390a-5p
    4.5
    PH01000002:155831-155851
    +
    GGTGCTATCCCAACTGAGATC
    CCGCGATAGGGAGGACTCGAA
    miRferno
    leucine-rich repeat receptor kinase EXS
    14
    phe-miR390a-5p
    5.5
    PH01000002:156579-156599
    +
    GGTTCTATCCCTGCTGAGATA
    CCGCGATAGGGAGGACTCGAA
    miRferno
    leucine-rich repeat receptor kinase EXS
    15
    phe-miR6198
    4.5
    PH01000002:151659-151680
    +
    AGAGTGCGCATGCAAGACAAAG
    TCTTACTGGTAGGTTCTGTGTC
    miRferno
    leucine-rich repeat receptor kinase EXS
    16
    phe-miR3948
    5.5
    PH01000002:150852-150875
    +
    TCCTCCCACTCCCGCTGCTCACGT
    ATGAGGGTGAGGGTGAGGTCTGGA
    miRferno
    leucine-rich repeat receptor kinase EXS
    17
    phe-miR528-5p
    5.0
    PH01000002:150712-150732
    +
    CTCCTCATCATGCCCCTCTCG
    GAGGAGACGTACGGGGAAGGT
    miRferno
    leucine-rich repeat receptor kinase EXS
    18
    phe-miR166a-5p
    4.5
    PH01000002:402289-402309
    +
    CCTTGAAACAGAAAGCATGAC
    GGAACTTGGTCTGTTGTAAGG
    miRferno
    ---NA---
    19
    phe-miR408a-5p
    4.5
    PH01000002:401907-401927
    +
    AATACGCTGCCTTGGCCCCGA
    GTACGCGACGGAGCAGGGACT
    miRferno
    ---NA---
    20
    phe-miR395f
    5
    PH01000002:2691004-2691023
    +
    GAGTGGCCCCTAACAATCAA
    CTCAAGGGGGTTTGTTAAGT
    miRferno
    Os01g0932600 [Oryza sativa Japonica Group]
    21
    phe-miR397-5p
    5.5
    PH01000003:110261-110279
    -
    CATCAAAGCTTCGATAAAT
    GTAGTTGCGACGTGAGTTA
    miRferno
    Os08g0121800 [Oryza sativa Japonica Group]
    22
    phe-miR2876-3p
    6.0
    PH01000003:110082-110105
    -
    GATGGCAATATTGAGCATATATGA
    CGACCGTTGTCACAAGTATATCCT
    miRferno
    Os08g0121800 [Oryza sativa Japonica Group]
    23
    phe-miR9780
    4.5
    PH01000003:1640693-1640711
    +
    CCGGGGAGCGCCGCCTCGA
    CGCACGTCGCGGCTGGGCT
    miRferno
    CASP 1C1
    24
    phe-miR170-3p
    5
    PH01000003:2361853-2361873
    -
    ACAGATAATGAAACTGCACAA
    TCTCTATAACTGTGCCGAGTT
    miRferno
    cold acclimation COR413-PM1 [Zea mays]
    25
    phe-miR2673a
    5.0
    PH01000003:2360424-2360442
    -
    CTCTTCATCTACCTTGTCT
    GAGAAGGAGAAGGAGAAGG
    miRferno
    cold acclimation COR413-PM1 [Zea mays]
    26
    phe-miR5153
    4.5
    PH01000004:137528-137548
    +
    GTGAATTCGAGTGCCATGTAG
    CACCTAAGGTGACTGTGCATC
    miRferno
    sister chromatid cohesion PDS5 homolog A
    27
    phe-miR159a.1
    4.5
    PH01000004:134387-134408
    +
    AAGCAGAGCAACCCTCAGTACA
    TTCGTCTCGAGGGAAGTTAGGT
    miRferno
    sister chromatid cohesion PDS5 homolog A
    28
    phe-miR169y
    5.5
    PH01000004:1135933-1135953
    +
    CTAGCAAGTCTTCCTTCACCG
    GGCCGTTCAGTAGGAAGCGAC
    miRferno
    alpha beta hydrolase domain-containing 11
    29
    phe-miR156f-5p
    5.0
    PH01000004:1135652-1135670
    +
    TGTTTTTTTTCTTCTGTCA
    ACGAGTGAGAGAAGACAGT
    miRferno
    alpha beta hydrolase domain-containing 11
    30
    phe-miR2673a
    5.5
    PH01000004:1135940-1135958
    +
    GTCTTCCTTCACCGCTTCC
    GAGAAGGAGAAGGAGAAGG
    miRferno
    alpha beta hydrolase domain-containing 11