Search By Other

 Search
 for  
 In 
       ?

Pinus taeda miRNA Target Genome sites

Total 59747 records in 1992 Pages. Current page: 1
1/1992 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1
pta-miR396
4.5
scaffold902269:28522-28542
+
AACTTGCAGAAAGCTGTGCAG
TTCAAGTTCTTTCGACACCTT
miRferno
protochlorophyllide chloroplastic
2
pta-miR952b
4.5
tscaffold5697:74575-74594
+
CACGACTGGCATTGTTATTT
GTGGTTACCGTAAGAGTCAA
miRferno
NAD(P)-binding Rossmann-fold superfamily isoform 1 [Theobroma cacao]
3
pta-miR156a
5.5
tscaffold5697:71888-71907
+
GATGTGCTCTCTTCCTATTT
CTACACGAGAGATAGAAGAC
miRferno
NAD(P)-binding Rossmann-fold superfamily isoform 1 [Theobroma cacao]
4
pta-miR1316
5
C31883086:6063-6083
-
CTCCAATGGTTTCAGCATTGA
AAGGTTACCAAACACATACCT
miRferno
ankyrin repeat domain-containing 12 [Populus euphratica]
5
pta-miR482c
5.0
C32014718:3048-3067
-
AATGGGAGCGATAGCAAAGG
TTACCCTCCTTATCCCTTCT
miRferno
uncharacterized zinc finger At4g06634
6
pta-miR482d
5
C32119058:9248-9267
-
AATTTGAGGAAATGGGAGGA
TTACCCTCCTCATCCCTCCT
miRferno
mitochondrial outer membrane porin 1-like
7
pta-miR1312
5
C32246902:5674-5695
+
ATATAGCCCTCCTCTCTCCAAA
TACAGCGGTAAAAGAGAGGTTT
miRferno
TMV resistance N-like [Prunus mume]
8
pta-miR950b;pta-miR950a
4.5
C32127060:1054-1073
-
ATTAACCACAGGGGTCCGGA
TATTTGGTGGCTCCTGGACT
miRferno
TMV resistance N-like
9
pta-miR951
4.5
C32127060:1043-1063
-
GGGGTCCGGACTGCAAGAAAA
CACCAGGTCTGCAGTTCTTGT
miRferno
TMV resistance N-like
10
pta-miR482d
5
C32340996:15523-15542
+
ATTGGAAGAAATAGGAAGGA
TTACCCTCCTCATCCCTCCT
miRferno
kinesin motor family [Populus trichocarpa]
11
pta-miR482c
4.0
C32340996:16558-16577
+
AAAGGGGGGAATAAGAAAGG
TTACCCTCCTTATCCCTTCT
miRferno
kinesin motor family [Populus trichocarpa]
12
pta-miR482c
5.0
C32340996:16821-16840
+
AGGGGGAGGACCAGGGAAGG
TTACCCTCCTTATCCCTTCT
miRferno
kinesin motor family [Populus trichocarpa]
13
pta-miR482c
4.5
C32340996:15523-15542
+
ATTGGAAGAAATAGGAAGGA
TTACCCTCCTTATCCCTTCT
miRferno
kinesin motor family [Populus trichocarpa]
14
pta-miR156b
5.0
C32340996:5657-5676
+
ATTGTGCTCTTTGCCTTCCG
CAACACGAGAGATAGAAGAC
miRferno
kinesin motor family [Populus trichocarpa]
15
pta-miR482b;pta-miR482a
4.0
C32358740:32817-32838
+
GGGATGGGAGGATTGGGGCTGA
CCTTACCCTCCTCATCCCTTCT
miRferno
(RS)-norcoclaurine 6-O-methyltransferase [Morus notabilis]
16
pta-miR482d
4.0
C32358740:32819-32838
+
GATGGGAGGATTGGGGCTGA
TTACCCTCCTCATCCCTCCT
miRferno
(RS)-norcoclaurine 6-O-methyltransferase [Morus notabilis]
17
pta-miR482c
4.0
C32358740:32819-32838
+
GATGGGAGGATTGGGGCTGA
TTACCCTCCTTATCCCTTCT
miRferno
(RS)-norcoclaurine 6-O-methyltransferase [Morus notabilis]
18
pta-miR952b
4.5
C32358740:29374-29393
+
CACCAAAGCCATTTTCAATG
GTGGTTACCGTAAGAGTCAA
miRferno
(RS)-norcoclaurine 6-O-methyltransferase [Morus notabilis]
19
pta-miR156a
5.0
C32358740:33466-33485
+
GAGGTGTTCCTTTTCTTCTG
CTACACGAGAGATAGAAGAC
miRferno
(RS)-norcoclaurine 6-O-methyltransferase [Morus notabilis]
20
pta-miR408
3
C32419046:34594-34614
+
GAAAGGGAAGAGGCAGAGCAT
CGGTCCCTTCTCCGTCACGTA
miRferno
vacuolar amino acid transporter 1-like isoform X1
21
pta-miR166c
3.5
C32419046:11043-11063
+
CTGGGCTGGAGCCTGGACCAG
GACCCTACTTCGGACCAGGCC
miRferno
vacuolar amino acid transporter 1-like isoform X1
22
pta-miR319
4.5
C32419046:8903-8921
+
GGCGATCCTTCCAGTCCAC
CCTCGAGGGAAGTCAGGTT
miRferno
vacuolar amino acid transporter 1-like isoform X1
23
pta-miR1316
4.5
C32325752:73-93
+
TGCCAAGGCTTCGTGTGTGGA
AAGGTTACCAAACACATACCT
miRferno
[Physcomitrella patens]
24
pta-miR482b;pta-miR482a
5
C32451298:42518-42539
+
GGATTAGGCGGAATAGGGAAGT
CCTTACCCTCCTCATCCCTTCT
miRferno
TMV resistance N-like
25
pta-miR482c
4
C32451298:42520-42539
+
ATTAGGCGGAATAGGGAAGT
TTACCCTCCTTATCCCTTCT
miRferno
TMV resistance N-like
26
pta-miR952a
4.0
C32424756:21456-21475
-
AACCAATGGTAAGATCAGTT
TTGGTTGCCGTACGAGACAA
miRferno
Aldolase-type TIM barrel family isoform 1 [Theobroma cacao]
27
pta-miR952a
4.0
C32424756:25973-25992
-
AACCAATGGTAAGATCAGTT
TTGGTTGCCGTACGAGACAA
miRferno
Aldolase-type TIM barrel family isoform 1 [Theobroma cacao]
28
pta-miR952b
4.5
C32424756:23640-23659
-
CAACATTGGCCATCTTAGTT
GTGGTTACCGTAAGAGTCAA
miRferno
Aldolase-type TIM barrel family isoform 1 [Theobroma cacao]
29
pta-miR952b
4.5
C32424756:25973-25992
-
AACCAATGGTAAGATCAGTT
GTGGTTACCGTAAGAGTCAA
miRferno
Aldolase-type TIM barrel family isoform 1 [Theobroma cacao]
30
pta-miR952b
4.5
C32424756:21456-21475
-
AACCAATGGTAAGATCAGTT
GTGGTTACCGTAAGAGTCAA
miRferno
Aldolase-type TIM barrel family isoform 1 [Theobroma cacao]
IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1/1992 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>