Search By Other

 Search
 for  
 In 
       ?

Pinus taeda miRNA Target Genome sites

Total 59747 records in 1992 Pages. Current page: 1
1/1992 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    pta-miR396
    4.5
    scaffold902269:28522-28542
    +
    AACTTGCAGAAAGCTGTGCAG
    TTCAAGTTCTTTCGACACCTT
    miRferno
    protochlorophyllide chloroplastic
    2
    pta-miR952b
    4.5
    tscaffold5697:74575-74594
    +
    CACGACTGGCATTGTTATTT
    GTGGTTACCGTAAGAGTCAA
    miRferno
    NAD(P)-binding Rossmann-fold superfamily isoform 1 [Theobroma cacao]
    3
    pta-miR156a
    5.5
    tscaffold5697:71888-71907
    +
    GATGTGCTCTCTTCCTATTT
    CTACACGAGAGATAGAAGAC
    miRferno
    NAD(P)-binding Rossmann-fold superfamily isoform 1 [Theobroma cacao]
    4
    pta-miR1316
    5
    C31883086:6063-6083
    -
    CTCCAATGGTTTCAGCATTGA
    AAGGTTACCAAACACATACCT
    miRferno
    ankyrin repeat domain-containing 12 [Populus euphratica]
    5
    pta-miR482c
    5.0
    C32014718:3048-3067
    -
    AATGGGAGCGATAGCAAAGG
    TTACCCTCCTTATCCCTTCT
    miRferno
    uncharacterized zinc finger At4g06634
    6
    pta-miR482d
    5
    C32119058:9248-9267
    -
    AATTTGAGGAAATGGGAGGA
    TTACCCTCCTCATCCCTCCT
    miRferno
    mitochondrial outer membrane porin 1-like
    7
    pta-miR1312
    5
    C32246902:5674-5695
    +
    ATATAGCCCTCCTCTCTCCAAA
    TACAGCGGTAAAAGAGAGGTTT
    miRferno
    TMV resistance N-like [Prunus mume]
    8
    pta-miR950b;pta-miR950a
    4.5
    C32127060:1054-1073
    -
    ATTAACCACAGGGGTCCGGA
    TATTTGGTGGCTCCTGGACT
    miRferno
    TMV resistance N-like
    9
    pta-miR951
    4.5
    C32127060:1043-1063
    -
    GGGGTCCGGACTGCAAGAAAA
    CACCAGGTCTGCAGTTCTTGT
    miRferno
    TMV resistance N-like
    10
    pta-miR482d
    5
    C32340996:15523-15542
    +
    ATTGGAAGAAATAGGAAGGA
    TTACCCTCCTCATCCCTCCT
    miRferno
    kinesin motor family [Populus trichocarpa]
    11
    pta-miR482c
    4.0
    C32340996:16558-16577
    +
    AAAGGGGGGAATAAGAAAGG
    TTACCCTCCTTATCCCTTCT
    miRferno
    kinesin motor family [Populus trichocarpa]
    12
    pta-miR482c
    5.0
    C32340996:16821-16840
    +
    AGGGGGAGGACCAGGGAAGG
    TTACCCTCCTTATCCCTTCT
    miRferno
    kinesin motor family [Populus trichocarpa]
    13
    pta-miR482c
    4.5
    C32340996:15523-15542
    +
    ATTGGAAGAAATAGGAAGGA
    TTACCCTCCTTATCCCTTCT
    miRferno
    kinesin motor family [Populus trichocarpa]
    14
    pta-miR156b
    5.0
    C32340996:5657-5676
    +
    ATTGTGCTCTTTGCCTTCCG
    CAACACGAGAGATAGAAGAC
    miRferno
    kinesin motor family [Populus trichocarpa]
    15
    pta-miR482b;pta-miR482a
    4.0
    C32358740:32817-32838
    +
    GGGATGGGAGGATTGGGGCTGA
    CCTTACCCTCCTCATCCCTTCT
    miRferno
    (RS)-norcoclaurine 6-O-methyltransferase [Morus notabilis]
    16
    pta-miR482d
    4.0
    C32358740:32819-32838
    +
    GATGGGAGGATTGGGGCTGA
    TTACCCTCCTCATCCCTCCT
    miRferno
    (RS)-norcoclaurine 6-O-methyltransferase [Morus notabilis]
    17
    pta-miR482c
    4.0
    C32358740:32819-32838
    +
    GATGGGAGGATTGGGGCTGA
    TTACCCTCCTTATCCCTTCT
    miRferno
    (RS)-norcoclaurine 6-O-methyltransferase [Morus notabilis]
    18
    pta-miR952b
    4.5
    C32358740:29374-29393
    +
    CACCAAAGCCATTTTCAATG
    GTGGTTACCGTAAGAGTCAA
    miRferno
    (RS)-norcoclaurine 6-O-methyltransferase [Morus notabilis]
    19
    pta-miR156a
    5.0
    C32358740:33466-33485
    +
    GAGGTGTTCCTTTTCTTCTG
    CTACACGAGAGATAGAAGAC
    miRferno
    (RS)-norcoclaurine 6-O-methyltransferase [Morus notabilis]
    20
    pta-miR408
    3
    C32419046:34594-34614
    +
    GAAAGGGAAGAGGCAGAGCAT
    CGGTCCCTTCTCCGTCACGTA
    miRferno
    vacuolar amino acid transporter 1-like isoform X1
    21
    pta-miR166c
    3.5
    C32419046:11043-11063
    +
    CTGGGCTGGAGCCTGGACCAG
    GACCCTACTTCGGACCAGGCC
    miRferno
    vacuolar amino acid transporter 1-like isoform X1
    22
    pta-miR319
    4.5
    C32419046:8903-8921
    +
    GGCGATCCTTCCAGTCCAC
    CCTCGAGGGAAGTCAGGTT
    miRferno
    vacuolar amino acid transporter 1-like isoform X1
    23
    pta-miR1316
    4.5
    C32325752:73-93
    +
    TGCCAAGGCTTCGTGTGTGGA
    AAGGTTACCAAACACATACCT
    miRferno
    [Physcomitrella patens]
    24
    pta-miR482b;pta-miR482a
    5
    C32451298:42518-42539
    +
    GGATTAGGCGGAATAGGGAAGT
    CCTTACCCTCCTCATCCCTTCT
    miRferno
    TMV resistance N-like
    25
    pta-miR482c
    4
    C32451298:42520-42539
    +
    ATTAGGCGGAATAGGGAAGT
    TTACCCTCCTTATCCCTTCT
    miRferno
    TMV resistance N-like
    26
    pta-miR952a
    4.0
    C32424756:21456-21475
    -
    AACCAATGGTAAGATCAGTT
    TTGGTTGCCGTACGAGACAA
    miRferno
    Aldolase-type TIM barrel family isoform 1 [Theobroma cacao]
    27
    pta-miR952a
    4.0
    C32424756:25973-25992
    -
    AACCAATGGTAAGATCAGTT
    TTGGTTGCCGTACGAGACAA
    miRferno
    Aldolase-type TIM barrel family isoform 1 [Theobroma cacao]
    28
    pta-miR952b
    4.5
    C32424756:23640-23659
    -
    CAACATTGGCCATCTTAGTT
    GTGGTTACCGTAAGAGTCAA
    miRferno
    Aldolase-type TIM barrel family isoform 1 [Theobroma cacao]
    29
    pta-miR952b
    4.5
    C32424756:25973-25992
    -
    AACCAATGGTAAGATCAGTT
    GTGGTTACCGTAAGAGTCAA
    miRferno
    Aldolase-type TIM barrel family isoform 1 [Theobroma cacao]
    30
    pta-miR952b
    4.5
    C32424756:21456-21475
    -
    AACCAATGGTAAGATCAGTT
    GTGGTTACCGTAAGAGTCAA
    miRferno
    Aldolase-type TIM barrel family isoform 1 [Theobroma cacao]