Search By Other

 Search
 for  
 In 
       ?

Populus trichocarpaV3 miRNA Target Genome sites

Total 86750 records in 2892 Pages. Current page: 1
1/2892 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    ptc-miR530b
    5.5
    Chr10:15737697-15737716
    +
    TGAATGCAGGTACAAATGCT
    TTCTACGTCCACGTTTACGT
    miRferno
    Galactokinase family [Populus trichocarpa]
    2
    ptc-miR172i
    5
    Chr10:15736435-15736455
    +
    ATGGATCATGATCATGATTCT
    AACGTCGTAGTAGTCCTAAGA
    miRferno
    Galactokinase family [Populus trichocarpa]
    3
    ptc-miR482b-5p
    3
    Chr10:15734511-15734531
    +
    TCTTGCCAACCAGGTCATGCC
    AGAACGGTTTGTGGAGTACGG
    miRferno
    Galactokinase family [Populus trichocarpa]
    4
    ptc-miR172d;ptc-miR172e
    4.5
    Chr10:15736435-15736455
    +
    ATGGATCATGATCATGATTCT
    TACGTCGTAGTAGTTCTAAGG
    miRferno
    Galactokinase family [Populus trichocarpa]
    5
    ptc-miR7823
    5
    Chr10:15735441-15735461
    +
    ATTTCAACCCCATTCAGGCAA
    TAAAGTTCAAGTACGTACGTT
    miRferno
    Galactokinase family [Populus trichocarpa]
    6
    ptc-miR1444b;ptc-miR1444c
    5.5
    Chr10:19098275-19098294
    +
    GAACGTAGATAAAATGTGAT
    CTTGCAACTGGCTTACACTT
    miRferno
    Pyrroline-5-carboxylate synthetase isoform 1 [Theobroma cacao]
    7
    ptc-miR6476a;ptc-miR6476b;ptc-miR6476c
    5.5
    Chr10:19091299-19091318
    +
    TAATGTTTCATGTGTACTGC
    AGTACAAAGTAGAGGTGACT
    miRferno
    Pyrroline-5-carboxylate synthetase isoform 1 [Theobroma cacao]
    8
    ptc-miR7834
    4.5
    Chr10:19094958-19094978
    +
    ATATTAGACCAGTTTTTATTG
    TATTATCAGCTCTAAAATAAT
    miRferno
    Pyrroline-5-carboxylate synthetase isoform 1 [Theobroma cacao]
    9
    ptc-miR476b
    5
    Chr10:20628201-20628221
    +
    TTTTGAAAAGAAGAAGAAGAA
    AAAACGTTTCTTCTTAATGAT
    miRferno
    PREDICTED: uncharacterized protein LOC105137154
    10
    ptc-miR6480
    5
    Chr10:11289203-11289223
    +
    TTAATTAAATAGTTTCAGCAC
    TATCAAGTTAGCAAAGTCGTT
    miRferno
    thermospermine synthase ACAULIS5-like [Populus euphratica]
    11
    ptc-miR6439a
    5
    Chr10:11289354-11289374
    +
    GGCTTCAGATTCTCCATTTAT
    CCGAAGACGAAGAAGTAAACC
    miRferno
    thermospermine synthase ACAULIS5-like [Populus euphratica]
    12
    ptc-miR828b-3p
    3.0
    Chr10:11286204-11286224
    +
    TGACATTTCTTGCTCTAATGG
    ATTATAAAGAACGAGCTTACT
    miRferno
    thermospermine synthase ACAULIS5-like [Populus euphratica]
    13
    ptc-miR6476a;ptc-miR6476b;ptc-miR6476c
    4.5
    Chr10:9140382-9140401
    +
    TGGTGTTTCATTTGCGCTGA
    AGTACAAAGTAGAGGTGACT
    miRferno
    haloacid dehalogenase-like hydrolase domain-containing At2g33255
    14
    ptc-miR6457a
    4.5
    Chr10:9141925-9141945
    +
    CAGCATTAAGCAGGGAGTTTC
    GTCGTAAGACGTCTCTCTAAT
    miRferno
    haloacid dehalogenase-like hydrolase domain-containing At2g33255
    15
    ptc-miR482a.1
    5
    Chr10:9141293-9141309
    +
    GGAATGGGAGCTTCATG
    CCTTACCCTCCTCATCC
    miRferno
    haloacid dehalogenase-like hydrolase domain-containing At2g33255
    16
    ptc-miR7826
    5
    Chr10:17983320-17983340
    -
    TTTGATTTTGAAACCTGTTAA
    ACTCTTAAACTTTGAACCATT
    miRferno
    probable sodium-coupled neutral amino acid transporter 6
    17
    ptc-miR6455
    4.5
    Chr10:17982516-17982536
    -
    AATGGTGAGAAAGCTTTTTGG
    TTACAACTCCTACGATAAACT
    miRferno
    probable sodium-coupled neutral amino acid transporter 6
    18
    ptc-miR482a.1
    4.5
    Chr10:17984496-17984512
    -
    GGAAAGGAAGGAGGGGG
    CCTTACCCTCCTCATCC
    miRferno
    probable sodium-coupled neutral amino acid transporter 6
    19
    ptc-miR1449
    4.5
    Chr10:1847502-1847523
    +
    GAGTTGTATTACATGCAACACA
    CTCAATAGAATGCACGTGGAGT
    miRferno
    BRCT domain-containing DNA repair isoform 1 [Theobroma cacao]
    20
    ptc-miR6473
    5.0
    Chr10:1847546-1847566
    +
    AAGTTGTAATGGGGTTGTGGT
    TTCAGAACTACCCTAACACCT
    miRferno
    BRCT domain-containing DNA repair isoform 1 [Theobroma cacao]
    21
    ptc-miR169y
    5
    Chr10:1844317-1844337
    +
    CTAGCACTTCATCCATGTCTT
    GTCCGTTAAGTAGGTACCGAT
    miRferno
    BRCT domain-containing DNA repair isoform 1 [Theobroma cacao]
    22
    ptc-miR1446a;ptc-miR1446b;ptc-miR1446c;ptc-miR1446
    5
    Chr10:1844882-1844901
    +
    CTGATGGTCAGATTTCAGAA
    AACTCCCTCTCTCAAGTCTT
    miRferno
    BRCT domain-containing DNA repair isoform 1 [Theobroma cacao]
    23
    ptc-miR6459b
    5.0
    Chr10:209970-209989
    +
    GATTTCAGTTGGGCTTGAGG
    CTAGCTTAAACCCGAACTCT
    miRferno
    novel plant SNARE 13
    24
    ptc-miR403a;ptc-miR403b;ptc-miR403c-3p;ptc-miR403d
    5.5
    Chr10:208463-208483
    +
    AGAGTTTGACCGTGAAATTAA
    GCTCAAACACGCACTTAGATT
    miRferno
    novel plant SNARE 13
    25
    ptc-miR476b
    5
    Chr10:209114-209134
    +
    GTTTGCACAGAAAAACTACCA
    AAAACGTTTCTTCTTAATGAT
    miRferno
    novel plant SNARE 13
    26
    ptc-miR7834
    5
    Chr10:209602-209622
    +
    ATATTTTTCCAGATTTTACTA
    TATTATCAGCTCTAAAATAAT
    miRferno
    novel plant SNARE 13
    27
    ptc-miR393a-5p;ptc-miR393b-5p;ptc-miR393c
    4.5
    Chr10:19320580-19320600
    -
    GATCAATGCAATTCGCATGGA
    CTAGTTACGCTAGGGAAACCT
    miRferno
    peptidyl-prolyl cis-trans isomerase FKBP20-1
    28
    ptc-miR7814
    4.0
    Chr10:19322425-19322445
    -
    TCAAAGTATTAATAAAATCTG
    AGTTTCGTATTTTTGTTAGAT
    miRferno
    peptidyl-prolyl cis-trans isomerase FKBP20-1
    29
    ptc-miR482a.1
    4.5
    Chr10:19321395-19321411
    -
    GGAAGGGGAAGGGAAAG
    CCTTACCCTCCTCATCC
    miRferno
    peptidyl-prolyl cis-trans isomerase FKBP20-1
    30
    ptc-miR6470
    5
    Chr10:19205927-19205947
    +
    TTTTTTATTTTAATATAAGTG
    AAAAAATTATACTATAGTCTC
    miRferno
    Beta-1,3-N-acetylglucosaminyltransferase lunatic isoform 1 [Theobroma cacao]