Search By Other

 Search
 for  
 In 
       ?

Populus trichocarpaV3 miRNA Target Genome sites

Total 86750 records in 2892 Pages. Current page: 1
1/2892 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1
ptc-miR530b
5.5
Chr10:15737697-15737716
+
TGAATGCAGGTACAAATGCT
TTCTACGTCCACGTTTACGT
miRferno
Galactokinase family [Populus trichocarpa]
2
ptc-miR172i
5
Chr10:15736435-15736455
+
ATGGATCATGATCATGATTCT
AACGTCGTAGTAGTCCTAAGA
miRferno
Galactokinase family [Populus trichocarpa]
3
ptc-miR482b-5p
3
Chr10:15734511-15734531
+
TCTTGCCAACCAGGTCATGCC
AGAACGGTTTGTGGAGTACGG
miRferno
Galactokinase family [Populus trichocarpa]
4
ptc-miR172d;ptc-miR172e
4.5
Chr10:15736435-15736455
+
ATGGATCATGATCATGATTCT
TACGTCGTAGTAGTTCTAAGG
miRferno
Galactokinase family [Populus trichocarpa]
5
ptc-miR7823
5
Chr10:15735441-15735461
+
ATTTCAACCCCATTCAGGCAA
TAAAGTTCAAGTACGTACGTT
miRferno
Galactokinase family [Populus trichocarpa]
6
ptc-miR1444b;ptc-miR1444c
5.5
Chr10:19098275-19098294
+
GAACGTAGATAAAATGTGAT
CTTGCAACTGGCTTACACTT
miRferno
Pyrroline-5-carboxylate synthetase isoform 1 [Theobroma cacao]
7
ptc-miR6476a;ptc-miR6476b;ptc-miR6476c
5.5
Chr10:19091299-19091318
+
TAATGTTTCATGTGTACTGC
AGTACAAAGTAGAGGTGACT
miRferno
Pyrroline-5-carboxylate synthetase isoform 1 [Theobroma cacao]
8
ptc-miR7834
4.5
Chr10:19094958-19094978
+
ATATTAGACCAGTTTTTATTG
TATTATCAGCTCTAAAATAAT
miRferno
Pyrroline-5-carboxylate synthetase isoform 1 [Theobroma cacao]
9
ptc-miR476b
5
Chr10:20628201-20628221
+
TTTTGAAAAGAAGAAGAAGAA
AAAACGTTTCTTCTTAATGAT
miRferno
PREDICTED: uncharacterized protein LOC105137154
10
ptc-miR6480
5
Chr10:11289203-11289223
+
TTAATTAAATAGTTTCAGCAC
TATCAAGTTAGCAAAGTCGTT
miRferno
thermospermine synthase ACAULIS5-like [Populus euphratica]
11
ptc-miR6439a
5
Chr10:11289354-11289374
+
GGCTTCAGATTCTCCATTTAT
CCGAAGACGAAGAAGTAAACC
miRferno
thermospermine synthase ACAULIS5-like [Populus euphratica]
12
ptc-miR828b-3p
3.0
Chr10:11286204-11286224
+
TGACATTTCTTGCTCTAATGG
ATTATAAAGAACGAGCTTACT
miRferno
thermospermine synthase ACAULIS5-like [Populus euphratica]
13
ptc-miR6476a;ptc-miR6476b;ptc-miR6476c
4.5
Chr10:9140382-9140401
+
TGGTGTTTCATTTGCGCTGA
AGTACAAAGTAGAGGTGACT
miRferno
haloacid dehalogenase-like hydrolase domain-containing At2g33255
14
ptc-miR6457a
4.5
Chr10:9141925-9141945
+
CAGCATTAAGCAGGGAGTTTC
GTCGTAAGACGTCTCTCTAAT
miRferno
haloacid dehalogenase-like hydrolase domain-containing At2g33255
15
ptc-miR482a.1
5
Chr10:9141293-9141309
+
GGAATGGGAGCTTCATG
CCTTACCCTCCTCATCC
miRferno
haloacid dehalogenase-like hydrolase domain-containing At2g33255
16
ptc-miR7826
5
Chr10:17983320-17983340
-
TTTGATTTTGAAACCTGTTAA
ACTCTTAAACTTTGAACCATT
miRferno
probable sodium-coupled neutral amino acid transporter 6
17
ptc-miR6455
4.5
Chr10:17982516-17982536
-
AATGGTGAGAAAGCTTTTTGG
TTACAACTCCTACGATAAACT
miRferno
probable sodium-coupled neutral amino acid transporter 6
18
ptc-miR482a.1
4.5
Chr10:17984496-17984512
-
GGAAAGGAAGGAGGGGG
CCTTACCCTCCTCATCC
miRferno
probable sodium-coupled neutral amino acid transporter 6
19
ptc-miR1449
4.5
Chr10:1847502-1847523
+
GAGTTGTATTACATGCAACACA
CTCAATAGAATGCACGTGGAGT
miRferno
BRCT domain-containing DNA repair isoform 1 [Theobroma cacao]
20
ptc-miR6473
5.0
Chr10:1847546-1847566
+
AAGTTGTAATGGGGTTGTGGT
TTCAGAACTACCCTAACACCT
miRferno
BRCT domain-containing DNA repair isoform 1 [Theobroma cacao]
21
ptc-miR169y
5
Chr10:1844317-1844337
+
CTAGCACTTCATCCATGTCTT
GTCCGTTAAGTAGGTACCGAT
miRferno
BRCT domain-containing DNA repair isoform 1 [Theobroma cacao]
22
ptc-miR1446a;ptc-miR1446b;ptc-miR1446c;ptc-miR1446
5
Chr10:1844882-1844901
+
CTGATGGTCAGATTTCAGAA
AACTCCCTCTCTCAAGTCTT
miRferno
BRCT domain-containing DNA repair isoform 1 [Theobroma cacao]
23
ptc-miR6459b
5.0
Chr10:209970-209989
+
GATTTCAGTTGGGCTTGAGG
CTAGCTTAAACCCGAACTCT
miRferno
novel plant SNARE 13
24
ptc-miR403a;ptc-miR403b;ptc-miR403c-3p;ptc-miR403d
5.5
Chr10:208463-208483
+
AGAGTTTGACCGTGAAATTAA
GCTCAAACACGCACTTAGATT
miRferno
novel plant SNARE 13
25
ptc-miR476b
5
Chr10:209114-209134
+
GTTTGCACAGAAAAACTACCA
AAAACGTTTCTTCTTAATGAT
miRferno
novel plant SNARE 13
26
ptc-miR7834
5
Chr10:209602-209622
+
ATATTTTTCCAGATTTTACTA
TATTATCAGCTCTAAAATAAT
miRferno
novel plant SNARE 13
27
ptc-miR393a-5p;ptc-miR393b-5p;ptc-miR393c
4.5
Chr10:19320580-19320600
-
GATCAATGCAATTCGCATGGA
CTAGTTACGCTAGGGAAACCT
miRferno
peptidyl-prolyl cis-trans isomerase FKBP20-1
28
ptc-miR7814
4.0
Chr10:19322425-19322445
-
TCAAAGTATTAATAAAATCTG
AGTTTCGTATTTTTGTTAGAT
miRferno
peptidyl-prolyl cis-trans isomerase FKBP20-1
29
ptc-miR482a.1
4.5
Chr10:19321395-19321411
-
GGAAGGGGAAGGGAAAG
CCTTACCCTCCTCATCC
miRferno
peptidyl-prolyl cis-trans isomerase FKBP20-1
30
ptc-miR6470
5
Chr10:19205927-19205947
+
TTTTTTATTTTAATATAAGTG
AAAAAATTATACTATAGTCTC
miRferno
Beta-1,3-N-acetylglucosaminyltransferase lunatic isoform 1 [Theobroma cacao]
IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1/2892 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>