Search By Other

 Search
 for  
 In 
       ?

Populus trichocarpaV3 miRNA Target Genome sites

Total 86750 records in 2892 Pages. Current page: 10

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    ptc-miR530b
    5.5
    Chr09:6487990-6488009
    -
    AAGAGGCAGCGGACAATGCA
    TTCTACGTCCACGTTTACGT
    miRferno
    nucleolin 1-like isoform X1
    2
    ptc-miR169u-3p
    5
    Chr09:6490528-6490548
    -
    GTACAGCCTCAGGAGACTGGC
    CCTATCGGTTTCCTCTGACGG
    miRferno
    nucleolin 1-like isoform X1
    3
    ptc-miR6459b
    5
    Chr09:6491840-6491859
    -
    TTTGGAATTTGTACTTGAGA
    CTAGCTTAAACCCGAACTCT
    miRferno
    nucleolin 1-like isoform X1
    4
    ptc-miR164f
    5.0
    Chr09:6486155-6486175
    -
    AGCATGTGCTCACCTTCTCTT
    TCGTACACGGGACGAAGAGGT
    miRferno
    nucleolin 1-like isoform X1
    5
    ptc-miR6476a;ptc-miR6476b;ptc-miR6476c
    4.5
    Chr09:6486631-6486650
    -
    TCATGTTTTCTTTTCCCTGA
    AGTACAAAGTAGAGGTGACT
    miRferno
    nucleolin 1-like isoform X1
    6
    ptc-miR478f
    5.5
    Chr09:6488947-6488970
    -
    TCTCTTAAAATAGTAAACATTTCT
    AGGGATTTTTATCTTCTGTACAGT
    miRferno
    nucleolin 1-like isoform X1
    7
    ptc-miR482a.2
    5.5
    Chr09:6490759-6490778
    -
    AATGGCAGGGATAAGGAAGA
    TTACCCTCCTCATCCGTTCT
    miRferno
    nucleolin 1-like isoform X1
    8
    ptc-miR482a.1
    5.5
    Chr09:6490764-6490780
    -
    GAAATGGCAGGGATAAG
    CCTTACCCTCCTCATCC
    miRferno
    nucleolin 1-like isoform X1
    9
    ptc-miR6459a-5p
    5
    Chr09:6491839-6491859
    -
    TTTGGAATTTGTACTTGAGAT
    CTAGCTTAAACACGAACTCGA
    miRferno
    nucleolin 1-like isoform X1
    10
    ptc-miR171g-5p
    4.0
    Chr09:7557715-7557735
    -
    TATGATTATGCTATCCAAACA
    GTACTAACTCGGTAGGGTTGT
    miRferno
    methylmalonate-semialdehyde dehydrogenase [acylating] mitochondrial-like [Vitis vinifera]
    11
    ptc-miR162a;ptc-miR162b
    5.5
    Chr09:7554166-7554186
    -
    CCGGATGCAGAGCTTGGTCCA
    GACCTACGTCTCCAAATAGCT
    miRferno
    methylmalonate-semialdehyde dehydrogenase [acylating] mitochondrial-like [Vitis vinifera]
    12
    ptc-miR171h-5p
    3.5
    Chr09:7557715-7557735
    -
    TATGATTATGCTATCCAAACA
    ATACTAACTCGGTAGGGTTGT
    miRferno
    methylmalonate-semialdehyde dehydrogenase [acylating] mitochondrial-like [Vitis vinifera]
    13
    ptc-miR482a.1
    5
    Chr09:7557395-7557411
    -
    GTATTACGAGGATTAGG
    CCTTACCCTCCTCATCC
    miRferno
    methylmalonate-semialdehyde dehydrogenase [acylating] mitochondrial-like [Vitis vinifera]
    14
    ptc-miR6451
    4.5
    Chr09:9048573-9048593
    -
    AGAGCTCACATGATTTTACAT
    TATGGATTGTACTAGACTGTA
    miRferno
    hypothetical protein POPTR_0009s10570g [Populus trichocarpa]
    15
    ptc-miR172h-5p
    5
    Chr09:9047837-9047857
    -
    TTTCAATCATGATTGTGCGCC
    ACACTTAGAACTACCACGAGG
    miRferno
    hypothetical protein POPTR_0009s10570g [Populus trichocarpa]
    16
    ptc-miR393a-3p;ptc-miR393b-3p
    4.5
    Chr09:9048580-9048600
    -
    GATCCAAAGAGCTCACATGAT
    TTAGGTTTCCCTATCGTACTA
    miRferno
    hypothetical protein POPTR_0009s10570g [Populus trichocarpa]
    17
    ptc-miR6470
    4.5
    Chr09:3876051-3876071
    -
    TTTATTGATATGATATCTGCT
    AAAAAATTATACTATAGTCTC
    miRferno
    GTP-binding ara-3 [Arabidopsis thaliana]
    18
    ptc-miR6464
    5.5
    Chr09:10657484-10657504
    -
    ATGCTGTCCAACAAGCAATTC
    TATTATAGGTTGTTCGTTAGT
    miRferno
    translocase of chloroplast chloroplastic-like
    19
    ptc-miR482b-3p
    3.5
    Chr09:10657921-10657942
    -
    TTGGAAAGACAGGTGTTGGTAA
    AACCGTACTCTCCATAACCATT
    miRferno
    translocase of chloroplast chloroplastic-like
    20
    ptc-miR482a.1
    5.5
    Chr09:10660265-10660281
    -
    GCAGGAGGAGGAGGAGG
    CCTTACCCTCCTCATCC
    miRferno
    translocase of chloroplast chloroplastic-like
    21
    ptc-miR6459b
    4.5
    Chr09:10396837-10396856
    -
    AATGGAACTTGGGCTTGTGG
    CTAGCTTAAACCCGAACTCT
    miRferno
    polyprenol reductase 2-like isoform X1
    22
    ptc-miR6463
    4.5
    Chr09:7757435-7757455
    -
    GATTGTCAACTTGATCAGCAA
    CCAACGGTTGTACTAGTAGGT
    miRferno
    malate dehydrogenase family [Populus trichocarpa]
    23
    ptc-miR393a-3p;ptc-miR393b-3p
    5
    Chr09:7757727-7757747
    -
    AATCCAATGGGTAAGAATCAT
    TTAGGTTTCCCTATCGTACTA
    miRferno
    malate dehydrogenase family [Populus trichocarpa]
    24
    ptc-miR1446a;ptc-miR1446b;ptc-miR1446c;ptc-miR1446
    5.5
    Chr09:7755528-7755547
    -
    TTGGCGGAAAGCATTCAGAA
    AACTCCCTCTCTCAAGTCTT
    miRferno
    malate dehydrogenase family [Populus trichocarpa]
    25
    ptc-miR6459a-3p
    4.5
    Chr09:6332339-6332359
    -
    CCTTATCAAGCCTAAATTCCA
    GTTAGAGTTCGGGTTTAAGCT
    miRferno
    Group [Theobroma cacao]
    26
    ptc-miR530b
    5.5
    Chr09:7029322-7029341
    +
    CAGATGCATGTATAAAGGCA
    TTCTACGTCCACGTTTACGT
    miRferno
    Signal peptide peptidase isoform 1 [Theobroma cacao]
    27
    ptc-miR7825
    4.0
    Chr09:7024910-7024931
    +
    CTCTCTGTCGACTTTTATTTAA
    GATAGACAGATGGAAAGAAGTT
    miRferno
    Signal peptide peptidase isoform 1 [Theobroma cacao]
    28
    ptc-miR171l-3p;ptc-miR171m;ptc-miR171j
    4.5
    Chr09:7026467-7026486
    +
    AGTGACATTGTTTTGGATCC
    TCACTATAACTAAGCCGAGC
    miRferno
    Signal peptide peptidase isoform 1 [Theobroma cacao]
    29
    ptc-miR6479
    5
    Chr09:7026947-7026967
    +
    GTCAGTAGATTTCTCATTGTT
    ACGTCATCATAAGAGTAACTA
    miRferno
    Signal peptide peptidase isoform 1 [Theobroma cacao]
    30
    ptc-miR6426a;ptc-miR6426b
    4.0
    Chr09:828905-828925
    +
    TCTTCCCTTGCAGGTTTCCAT
    AGAAGTGAAGGTACAGAGGTG
    miRferno
    cyclin-dependent kinase inhibitor SMR2