Search By Other

 Search
 for  
 In 
       ?

Populus trichocarpaV3 miRNA Target Genome sites

Total 86750 records in 2892 Pages. Current page: 5

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    ptc-miR7818
    4.0
    Chr10:6719412-6719432
    -
    CGTCAAGTTATTGATGATAAA
    GCAGATCACTAGCTATTCTTT
    miRferno
    phospholipid-transporting ATPase 3
    2
    ptc-miR1446a;ptc-miR1446b;ptc-miR1446c;ptc-miR1446
    5
    Chr10:15526533-15526552
    +
    TTGAAGGAGAGAAGGCAAAA
    AACTCCCTCTCTCAAGTCTT
    miRferno
    microtubule-associated futsch-like
    3
    ptc-miR482a.1
    3
    Chr10:15526567-15526583
    +
    GGAAGAGGAGGAGGAGG
    CCTTACCCTCCTCATCC
    miRferno
    microtubule-associated futsch-like
    4
    ptc-miR482a.1
    5.5
    Chr10:15526570-15526586
    +
    AGAGGAGGAGGAGGAGG
    CCTTACCCTCCTCATCC
    miRferno
    microtubule-associated futsch-like
    5
    ptc-miR482a.1
    5.5
    Chr10:15526573-15526589
    +
    GGAGGAGGAGGAGGAAG
    CCTTACCCTCCTCATCC
    miRferno
    microtubule-associated futsch-like
    6
    ptc-miR172g-3p;ptc-miR172h-3p
    5
    Chr10:9751747-9751767
    -
    CAGCAGCATAATCCTGCTTCC
    GACGTCGTAGTAGTTCTAAGG
    miRferno
    LIGHT-DEPENDENT SHORT HYPOCOTYLS 4
    7
    ptc-miR172i
    0
    Chr10:20336400-20336420
    +
    TTGCAGCATCATCAGGATTCT
    AACGTCGTAGTAGTCCTAAGA
    miRferno
    DNA binding [Ricinus communis]
    8
    ptc-miR6450b
    5
    Chr10:20336558-20336578
    +
    AAACCTTGAGTGCGGTGTCCG
    ATCGGAACTCAGGACACAAGC
    miRferno
    DNA binding [Ricinus communis]
    9
    ptc-miR172d;ptc-miR172e
    2.0
    Chr10:20336400-20336420
    +
    TTGCAGCATCATCAGGATTCT
    TACGTCGTAGTAGTTCTAAGG
    miRferno
    DNA binding [Ricinus communis]
    10
    ptc-miR172g-3p;ptc-miR172h-3p
    1.5
    Chr10:20336400-20336420
    +
    TTGCAGCATCATCAGGATTCT
    GACGTCGTAGTAGTTCTAAGG
    miRferno
    DNA binding [Ricinus communis]
    11
    ptc-miR172i
    5
    Chr10:13267226-13267246
    -
    CTGCAGCATCAACAGAAATGT
    AACGTCGTAGTAGTCCTAAGA
    miRferno
    Heavy metal transport detoxification superfamily isoform 1 [Theobroma cacao]
    12
    ptc-miR7826
    4.0
    Chr17:10301983-10302003
    +
    TGGGGATTTGATACTTGCTCA
    ACTCTTAAACTTTGAACCATT
    miRferno
    RNA-binding KH domain-containing isoform 1 [Theobroma cacao]
    13
    ptc-miR7834
    5.5
    Chr17:1788277-1788297
    -
    ATAACAGTCCAGATTTGATGG
    TATTATCAGCTCTAAAATAAT
    miRferno
    DELLA GAIP-B-like
    14
    ptc-miR168a-3p;ptc-miR168b-3p
    5
    Chr17:12702571-12702591
    -
    ATTCACTTGATGCCCAGAGGG
    TAAGTCAACTACGTTCCGCCC
    miRferno
    nuclear matrix constituent 1 [Populus trichocarpa]
    15
    ptc-miR6459a-3p
    5
    Chr17:12702107-12702127
    -
    CAAACTCAAGGCCAAACACAA
    GTTAGAGTTCGGGTTTAAGCT
    miRferno
    nuclear matrix constituent 1 [Populus trichocarpa]
    16
    ptc-miR6426a;ptc-miR6426b
    5.5
    Chr17:12705149-12705169
    -
    TCCTCCCTTCTTTGTCTGCAC
    AGAAGTGAAGGTACAGAGGTG
    miRferno
    nuclear matrix constituent 1 [Populus trichocarpa]
    17
    ptc-miR482a.1
    5
    Chr17:12707122-12707138
    -
    TGAATGGAAGCAGTTTG
    CCTTACCCTCCTCATCC
    miRferno
    nuclear matrix constituent 1 [Populus trichocarpa]
    18
    ptc-miR482a.1
    5
    Chr17:12705016-12705032
    -
    AGAATGGGAGAAGAAAT
    CCTTACCCTCCTCATCC
    miRferno
    nuclear matrix constituent 1 [Populus trichocarpa]
    19
    ptc-miR482a.1
    5
    Chr17:12705034-12705050
    -
    GCAAAGGGAGGACTTGC
    CCTTACCCTCCTCATCC
    miRferno
    nuclear matrix constituent 1 [Populus trichocarpa]
    20
    ptc-miR167f-3p;ptc-miR167g-3p;ptc-miR167h-3p
    4.5
    Chr17:16066422-16066442
    -
    GGAAAAACAGCCACGTAATCT
    CCACTTTGACGGTGTACTAGA
    miRferno
    PREDICTED: uncharacterized protein LOC105140815
    21
    ptc-miR7826
    5.5
    Chr17:1385638-1385658
    -
    TTGGACTTTGAAACTTTGCAA
    ACTCTTAAACTTTGAACCATT
    miRferno
    homeobox [Ricinus communis]
    22
    ptc-miR7835
    4.0
    Chr17:1386470-1386490
    -
    TACTTCACAAAAAATCCCTTT
    GTGAAGGGCTTTTTAGGGTAG
    miRferno
    homeobox [Ricinus communis]
    23
    ptc-miR482a.2
    3.5
    Chr17:1377920-1377939
    -
    AGTGTGAGAAGTAGGCAAAA
    TTACCCTCCTCATCCGTTCT
    miRferno
    homeobox [Ricinus communis]
    24
    ptc-miR482a.1
    3.5
    Chr17:1377925-1377941
    -
    GCAGTGTGAGAAGTAGG
    CCTTACCCTCCTCATCC
    miRferno
    homeobox [Ricinus communis]
    25
    ptc-miR482a.1
    5
    Chr17:1387686-1387702
    -
    GTAATATGTGGAGTATG
    CCTTACCCTCCTCATCC
    miRferno
    homeobox [Ricinus communis]
    26
    ptc-miR530b
    4
    Chr17:3212830-3212849
    +
    ATGCTGCAGTTGCAAAAGCA
    TTCTACGTCCACGTTTACGT
    miRferno
    midasin-related family [Populus trichocarpa]
    27
    ptc-miR530b
    5.5
    Chr17:3211770-3211789
    +
    AAGATGGAAGAGCAGTTGCA
    TTCTACGTCCACGTTTACGT
    miRferno
    midasin-related family [Populus trichocarpa]
    28
    ptc-miR530b
    4.5
    Chr17:3182261-3182280
    +
    CAGTTGCAGGTGGAAGTTCA
    TTCTACGTCCACGTTTACGT
    miRferno
    midasin-related family [Populus trichocarpa]
    29
    ptc-miR1444b;ptc-miR1444c
    5
    Chr17:3194481-3194500
    +
    CAACGTTGTCAGAATCTGAT
    CTTGCAACTGGCTTACACTT
    miRferno
    midasin-related family [Populus trichocarpa]
    30
    ptc-miR7824
    3.0
    Chr17:3178584-3178604
    +
    GTTTTGATTGATTTTTCTTAA
    CCAGGCTAACTGAAAAGAGTT
    miRferno
    midasin-related family [Populus trichocarpa]