Search By Other

 Search
 for  
 In 
       ?

Populus trichocarpaV3 miRNA Target Genome sites

Total 86750 records in 2892 Pages. Current page: 7

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    ptc-miR482a.1
    5
    Chr17:14870611-14870627
    +
    GGAATGGTTGATGAAGG
    CCTTACCCTCCTCATCC
    miRferno
    pentatricopeptide repeat-containing At5g66520-like [Vitis vinifera]
    2
    ptc-miR6476a;ptc-miR6476b;ptc-miR6476c
    4.5
    Chr17:2426912-2426931
    +
    TCATGCATGATCTACACTGG
    AGTACAAAGTAGAGGTGACT
    miRferno
    ---NA---
    3
    ptc-miR6442
    4.5
    Chr17:5444853-5444873
    -
    CGGGCCCTTCAAGCTTTTCAT
    GCACGGGAAGTTCGGCAAGTC
    miRferno
    serine hydroxymethyltransferase 4
    4
    ptc-miR6421-3p
    5
    Chr17:8156534-8156554
    -
    CTTAGCTTACTATCAGCTCAA
    GAAGGGAATGTTAGACGAGAT
    miRferno
    hypothetical protein POPTR_0017s10720g [Populus trichocarpa]
    5
    ptc-miR6470
    3.5
    Chr17:8155997-8156017
    -
    AATTTTAATATGATATTATAG
    AAAAAATTATACTATAGTCTC
    miRferno
    hypothetical protein POPTR_0017s10720g [Populus trichocarpa]
    6
    ptc-miR482a.1
    5
    Chr17:8156103-8156119
    -
    TGAATCGGAGGACAAGA
    CCTTACCCTCCTCATCC
    miRferno
    hypothetical protein POPTR_0017s10720g [Populus trichocarpa]
    7
    ptc-miR530b
    4.0
    Chr17:4387682-4387701
    +
    TTGATGCAGGTGTAGATGGA
    TTCTACGTCCACGTTTACGT
    miRferno
    nitronate monooxygenase [Populus euphratica]
    8
    ptc-miR396e-3p
    5.5
    Chr17:4388125-4388144
    +
    TCTCATACTGCTTTCATGAT
    AGAGGGTGTCGAAAGAACTC
    miRferno
    nitronate monooxygenase [Populus euphratica]
    9
    ptc-miR482a.1
    5.0
    Chr17:4386792-4386808
    +
    GTAATGGGGGAAGTGAG
    CCTTACCCTCCTCATCC
    miRferno
    nitronate monooxygenase [Populus euphratica]
    10
    ptc-miR169ac;ptc-miR169ad;ptc-miR169ae;ptc-miR169a
    5.0
    Chr17:901123-901143
    +
    TGGAAAAGATGTCTTTGGCTA
    ACCCGTTCAGCAGGAACCGAT
    miRferno
    O-acyltransferase WSD1-like
    11
    ptc-miR6473
    4.5
    Chr17:901261-901281
    +
    ATGTGTTGATGGGGTTGCAGA
    TTCAGAACTACCCTAACACCT
    miRferno
    O-acyltransferase WSD1-like
    12
    ptc-miR7823
    5.5
    Chr17:900341-900361
    +
    ATTTAAAGTAATTGCATGCAT
    TAAAGTTCAAGTACGTACGTT
    miRferno
    O-acyltransferase WSD1-like
    13
    ptc-miR6480
    4.5
    Chr17:4229714-4229734
    +
    ATGGTTGAGTTCTTTCAGCAA
    TATCAAGTTAGCAAAGTCGTT
    miRferno
    phytosulfokine receptor 1-like
    14
    ptc-miR172d;ptc-miR172e
    5.5
    Chr17:7619635-7619655
    +
    ATGCAACATCATCAATATGTG
    TACGTCGTAGTAGTTCTAAGG
    miRferno
    hypothetical protein POPTR_0017s09985g [Populus trichocarpa]
    15
    ptc-miR156g;ptc-miR156h;ptc-miR156i;ptc-miR156j
    3.5
    Chr17:8906924-8906944
    +
    GTGTTTTCTATATTTTTTCAA
    CACGAGAGATAGAAGACAGTT
    miRferno
    cleavage and polyadenylation specificity factor subunit 3-I isoform X1 [Populus euphratica]
    16
    ptc-miR6473
    4
    Chr17:8910215-8910235
    +
    AAGTGTTGATGGGAATGTAGC
    TTCAGAACTACCCTAACACCT
    miRferno
    cleavage and polyadenylation specificity factor subunit 3-I isoform X1 [Populus euphratica]
    17
    ptc-miR1447
    5.5
    Chr17:10806406-10806426
    -
    CATCAAGGATTTTCAATTCTG
    TTAGTTCCGTGACGTTAAGAC
    miRferno
    membrane-anchored ubiquitin-fold 1-like [Pyrus x bretschneideri]
    18
    ptc-miR6435
    5
    Chr17:14290654-14290674
    -
    CAAAAGTTGCTGCATTATTCA
    GATCTCACAGAGGTAATAAGT
    miRferno
    methionine aminopeptidase 2B [Arabidopsis thaliana]
    19
    ptc-miR6421-5p
    5
    Chr17:14290539-14290559
    -
    GAATGAGTAGCTTGGAAGCTA
    CTTTCTCATCTAACATTCCCT
    miRferno
    methionine aminopeptidase 2B [Arabidopsis thaliana]
    20
    ptc-miR7831
    5
    Chr17:14292327-14292347
    -
    GTTTGGTGTCATCTTCTTGTA
    CAAACCACCAGAGATGTACAT
    miRferno
    methionine aminopeptidase 2B [Arabidopsis thaliana]
    21
    ptc-miR7826
    2.5
    Chr17:14319140-14319160
    +
    TGAGGATTTGGAGCTTGGAAA
    ACTCTTAAACTTTGAACCATT
    miRferno
    disease resistance RGA4 isoform X1 [Populus euphratica]
    22
    ptc-miR472b
    4
    Chr17:14316648-14316669
    +
    GGAATGGGGGGACTAGGGAAAA
    CCCTACCCACCTCAACCCTTTT
    miRferno
    disease resistance RGA4 isoform X1 [Populus euphratica]
    23
    ptc-miR482c-3p
    4.0
    Chr17:14316648-14316669
    +
    GGAATGGGGGGACTAGGGAAAA
    CCATACCCTCCTGAGCCTTTCT
    miRferno
    disease resistance RGA4 isoform X1 [Populus euphratica]
    24
    ptc-miR482a.2
    3.5
    Chr17:14316650-14316669
    +
    AATGGGGGGACTAGGGAAAA
    TTACCCTCCTCATCCGTTCT
    miRferno
    disease resistance RGA4 isoform X1 [Populus euphratica]
    25
    ptc-miR472a
    3
    Chr17:14316648-14316669
    +
    GGAATGGGGGGACTAGGGAAAA
    CCCTACCCACCTCATCCCTTTT
    miRferno
    disease resistance RGA4 isoform X1 [Populus euphratica]
    26
    ptc-miR482a.1
    1.5
    Chr17:14316648-14316664
    +
    GGAATGGGGGGACTAGG
    CCTTACCCTCCTCATCC
    miRferno
    disease resistance RGA4 isoform X1 [Populus euphratica]
    27
    ptc-miR482a.1
    4.5
    Chr17:14317720-14317736
    +
    GGAATGGATGGGGAAAG
    CCTTACCCTCCTCATCC
    miRferno
    disease resistance RGA4 isoform X1 [Populus euphratica]
    28
    ptc-miR482a.1
    5.5
    Chr17:14317361-14317377
    +
    GGAGAGGGAGGAGCTGA
    CCTTACCCTCCTCATCC
    miRferno
    disease resistance RGA4 isoform X1 [Populus euphratica]
    29
    ptc-miR156a;ptc-miR156b;ptc-miR156c;ptc-miR156d;pt
    5.0
    Chr17:14845386-14845405
    +
    GTGCTTACCTTGTTCTGTCT
    CACGAGTGAGAGAAGACAGT
    miRferno
    microsomal glutathione S-transferase 3-like
    30
    ptc-miR482a.1
    5
    Chr17:14844907-14844923
    +
    ATCATGGCAGGAGTAGA
    CCTTACCCTCCTCATCC
    miRferno
    microsomal glutathione S-transferase 3-like