Search By Other

 Search
 for  
 In 
       ?

Populus trichocarpaV3 miRNA Target Genome sites

Total 86750 records in 2892 Pages. Current page: 8

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    ptc-miR6464
    4
    Chr17:11688463-11688483
    +
    ATAATATCAAACAAACACGCA
    TATTATAGGTTGTTCGTTAGT
    miRferno
    UDP-arabinopyranose mutase 1
    2
    ptc-miR172i
    4.5
    Chr17:11686339-11686359
    +
    TTGCAGGATCCTTAGAATTAT
    AACGTCGTAGTAGTCCTAAGA
    miRferno
    UDP-arabinopyranose mutase 1
    3
    ptc-miR7823
    5.0
    Chr17:11687490-11687510
    +
    GTTTTTAATACATGCATGCAA
    TAAAGTTCAAGTACGTACGTT
    miRferno
    UDP-arabinopyranose mutase 1
    4
    ptc-miR7826
    5
    Chr17:11975992-11976012
    +
    TAATAATTTGAAAGTTTGAAA
    ACTCTTAAACTTTGAACCATT
    miRferno
    TMV resistance N-like isoform X2
    5
    ptc-miR7817a
    5.5
    Chr17:11967411-11967431
    +
    TTTCATTAGACAATAAACAAA
    ACAGAGCTCTGTTATTGGTTT
    miRferno
    TMV resistance N-like isoform X2
    6
    ptc-miR172i
    5.0
    Chr17:11973740-11973760
    +
    TTGCAAAAGTATTAGGATTCT
    AACGTCGTAGTAGTCCTAAGA
    miRferno
    TMV resistance N-like isoform X2
    7
    ptc-miR172b-5p;ptc-miR172g-5p
    4.5
    Chr17:11972546-11972566
    +
    ATTGAATGATGATGATGCTCT
    ACACTTAGAACTACTACGAGG
    miRferno
    TMV resistance N-like isoform X2
    8
    ptc-miR1448
    5
    Chr17:11972158-11972177
    +
    GAATGGGTGGCATAGGTAAG
    CATACCCTCCGCAACCTTTC
    miRferno
    TMV resistance N-like isoform X2
    9
    ptc-miR482a.2
    4.0
    Chr17:11972159-11972178
    +
    AATGGGTGGCATAGGTAAGA
    TTACCCTCCTCATCCGTTCT
    miRferno
    TMV resistance N-like isoform X2
    10
    ptc-miR472a
    5.0
    Chr17:11972157-11972178
    +
    GGAATGGGTGGCATAGGTAAGA
    CCCTACCCACCTCATCCCTTTT
    miRferno
    TMV resistance N-like isoform X2
    11
    ptc-miR482a.1
    3
    Chr17:11972157-11972173
    +
    GGAATGGGTGGCATAGG
    CCTTACCCTCCTCATCC
    miRferno
    TMV resistance N-like isoform X2
    12
    ptc-miR482a.1
    4
    Chr17:11970923-11970939
    +
    GGCATGTGAGGAGTAAT
    CCTTACCCTCCTCATCC
    miRferno
    TMV resistance N-like isoform X2
    13
    ptc-miR482a.1
    5.5
    Chr17:11976413-11976429
    +
    GGAGCGGGAGCAGGAGC
    CCTTACCCTCCTCATCC
    miRferno
    TMV resistance N-like isoform X2
    14
    ptc-miR482a.1
    5
    Chr17:11968349-11968365
    +
    GGAATGGGTGGTGGCTG
    CCTTACCCTCCTCATCC
    miRferno
    TMV resistance N-like isoform X2
    15
    ptc-miR159a;ptc-miR159b
    4.5
    Chr17:14077649-14077669
    -
    GAGAGATACCTTCATTCCAGA
    ATCTCGAGGGAAGTTAGGTTT
    miRferno
    Calmodulin-binding heat-shock [Theobroma cacao]
    16
    ptc-miR396g-3p
    5
    Chr17:14078649-14078669
    -
    TTTTCGCTGGGCATTCTTTAG
    AAAAGGGTGCCGAAAGAACTC
    miRferno
    Calmodulin-binding heat-shock [Theobroma cacao]
    17
    ptc-miR319a;ptc-miR319b;ptc-miR319c;ptc-miR319d
    4.5
    Chr17:14077650-14077669
    -
    GAGAGATACCTTCATTCCAG
    CCCTCGAGGGAAGTCAGGTT
    miRferno
    Calmodulin-binding heat-shock [Theobroma cacao]
    18
    ptc-miR482a.1
    4
    Chr17:14075717-14075733
    -
    GCAATGGGAGAAGATGG
    CCTTACCCTCCTCATCC
    miRferno
    Calmodulin-binding heat-shock [Theobroma cacao]
    19
    ptc-miR482a.2
    5.0
    Chr17:10750173-10750192
    +
    CATGGGAGGAGAGGACGAGA
    TTACCCTCCTCATCCGTTCT
    miRferno
    cyclic nucleotide-gated ion channel 2-like
    20
    ptc-miR482a.1
    5.5
    Chr17:10750171-10750187
    +
    GTCATGGGAGGAGAGGA
    CCTTACCCTCCTCATCC
    miRferno
    cyclic nucleotide-gated ion channel 2-like
    21
    ptc-miR3627a
    6.0
    Chr17:12364464-12364485
    +
    GTACTCTCTTTCCAGCAACAAG
    CATGGTAGAAAGGTCGCTGTCT
    miRferno
    WPP domain-interacting tail-anchored 1 [Vitis vinifera]
    22
    ptc-miR475a-5p;ptc-miR475b-5p;ptc-miR475d-5p
    5
    Chr17:12361747-12361767
    +
    TGGAATGATACAATGGCCATT
    AGATGAGAATGTTACCGGTAA
    miRferno
    WPP domain-interacting tail-anchored 1 [Vitis vinifera]
    23
    ptc-miR6459a-3p
    5.5
    Chr17:12361161-12361181
    +
    CAATCATCAGCCGAAATTGGA
    GTTAGAGTTCGGGTTTAAGCT
    miRferno
    WPP domain-interacting tail-anchored 1 [Vitis vinifera]
    24
    ptc-miR828a;ptc-miR828b-5p
    5
    Chr17:12367305-12367326
    +
    TATATTACTCATTTCAGCAATA
    ACCTTATGAGTAAACTCGTTCT
    miRferno
    WPP domain-interacting tail-anchored 1 [Vitis vinifera]
    25
    ptc-miR828b-3p
    5.5
    Chr17:12361240-12361260
    +
    TTATCTTGCTTGCTCTGATGA
    ATTATAAAGAACGAGCTTACT
    miRferno
    WPP domain-interacting tail-anchored 1 [Vitis vinifera]
    26
    ptc-miR482a.1
    5.5
    Chr17:12365899-12365915
    +
    GGAAGGGGAGAGAGAGG
    CCTTACCCTCCTCATCC
    miRferno
    WPP domain-interacting tail-anchored 1 [Vitis vinifera]
    27
    ptc-miR482a.1
    5
    Chr17:12361298-12361314
    +
    GAATTGGAATGAGGAGG
    CCTTACCCTCCTCATCC
    miRferno
    WPP domain-interacting tail-anchored 1 [Vitis vinifera]
    28
    ptc-miR482a.1
    5
    Chr17:12361258-12361274
    +
    TGAATGGGAGGTAGATG
    CCTTACCCTCCTCATCC
    miRferno
    WPP domain-interacting tail-anchored 1 [Vitis vinifera]
    29
    ptc-miR6455
    4.5
    scaffold_508:5983-6003
    -
    AATGTTGTGTTTGCTGTTTAA
    TTACAACTCCTACGATAAACT
    miRferno
    TRIGALACTOSYLDIACYLGLYCEROL chloroplastic
    30
    ptc-miR7814
    4.5
    scaffold_508:6726-6746
    -
    TCAAAGAATAGAATCTATCAA
    AGTTTCGTATTTTTGTTAGAT
    miRferno
    TRIGALACTOSYLDIACYLGLYCEROL chloroplastic