Search By Other

 Search
 for  
 In 
       ?

Sorghum bicolor miRNA Target Genome sites

Total 67744 records in 2259 Pages. Current page: 1
1/2259 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    sbi-miR821e
    5
    chr1:1256796-1256816
    -
    CAACTTGAATTTTAATGAAAT
    GTTGAAAATAAAACTACTGAA
    miRferno
    NRPB8B; DNA-directed RNA polymerase
    2
    sbi-miR1435b
    4.5
    chr1:1257748-1257767
    -
    AAAAAGTTTGACAAAGGTAA
    TTTTCCAAACTGAATTCTTT
    miRferno
    NRPB8B; DNA-directed RNA polymerase
    3
    sbi-miR1435a
    4.5
    chr1:1257748-1257767
    -
    AAAAAGTTTGACAAAGGTAA
    CTTTTCAAACTGAATTCTTT
    miRferno
    NRPB8B; DNA-directed RNA polymerase
    4
    sbi-miR5384
    3.5
    chr10:54070066-54070083
    +
    CCGCTGGATGGCGCCGGA
    GGCGACCTGCCGCCGCGC
    miRferno
    HT1 (high leaf temperature 1); kinase/ protein serine/threonine/tyrosine kinase
    5
    sbi-miR5565e
    5
    chr4:57514054-57514072
    +
    TCCAACAACAACAACAAAA
    AGGCTGTTGTAGGTTTGTT
    miRferno
    tetratricopeptide repeat (TPR)-containing protein
    6
    sbi-miR5384
    5
    chr4:57511696-57511713
    +
    GCCCAGGCCGGCGGCGGG
    GGCGACCTGCCGCCGCGC
    miRferno
    tetratricopeptide repeat (TPR)-containing protein
    7
    sbi-miR5384
    4
    chr4:10645579-10645596
    -
    CAGCCGGACGGCGGCGAC
    GGCGACCTGCCGCCGCGC
    miRferno
    zinc finger (C3HC4-type RING finger) family protein
    8
    sbi-miR5384
    4.0
    chr4:10645558-10645575
    -
    TCGCCGGACTGCGCCGTG
    GGCGACCTGCCGCCGCGC
    miRferno
    zinc finger (C3HC4-type RING finger) family protein
    9
    sbi-miR172e
    5
    chr5:57128988-57129008
    -
    GTACAACAACACAAAGATTCA
    CACGTCGTAGTAGTTCTAAGT
    miRferno
    GRF10 (GENERAL REGULATORY FACTOR 10); ATP binding / protein binding / protein phosphorylated amino acid binding
    10
    sbi-miR5564c-5p
    5.5
    chr5:57133152-57133172
    -
    ACTGCAGCTGTTCGATCACTG
    CGACGTCGACAAGCTGCTTAA
    miRferno
    GRF10 (GENERAL REGULATORY FACTOR 10); ATP binding / protein binding / protein phosphorylated amino acid binding
    11
    sbi-miR5565b;sbi-miR5565a
    3.0
    chr5:44058996-44059019
    -
    GATTCACTTTAATCCATGTGTGTT
    CTAAGCGGAGTTAGGTGTACACAA
    miRferno
    unknown protein
    12
    sbi-miR5565e
    1
    chr5:44058906-44058924
    -
    TCAGACAACATCCAAACAA
    AGGCTGTTGTAGGTTTGTT
    miRferno
    unknown protein
    13
    sbi-miR5565g-3p
    5.0
    chr5:44058997-44059020
    -
    GGATTCACTTTAATCCATGTGTGT
    CATAAGTAGAGTTAGGTGTACACA
    miRferno
    unknown protein
    14
    sbi-miR5384
    4.5
    chr5:44058587-44058604
    -
    CTGGTGAACGGCGGCCAG
    GGCGACCTGCCGCCGCGC
    miRferno
    unknown protein
    15
    sbi-miR5565c
    3.0
    chr5:44058996-44059016
    -
    TCACTTTAATCCATGTGTGTT
    AGTGGAGTTAGGTGTACACAT
    miRferno
    unknown protein
    16
    sbi-miR5565g-5p
    4.0
    chr5:44058925-44058948
    -
    TTAACACATGCGGATTGATATGAA
    GGTTGTATACACCTAACTACACTT
    miRferno
    unknown protein
    17
    sbi-miR5565f
    2.5
    chr5:44058917-44058936
    -
    GATTGATATGAATCAGACAA
    CTAACTATATTTAGGCTGAT
    miRferno
    unknown protein
    18
    sbi-miR172b
    5
    chr2:69070745-69070764
    -
    TACACCATCATGAAAATTAC
    ACGTCGTAGTAGTTCTAAGG
    miRferno
    cathepsin B-like cysteine protease, putative
    19
    sbi-miR5570
    4.5
    chr4:8675393-8675413
    -
    TGATATACTGATTTGTAATGT
    ACTGTACGACTAAACAGAAAA
    miRferno
    unknown protein
    20
    sbi-miR169d-5p
    4.5
    chr4:8667250-8667269
    -
    AGTCAAGTTATACTTGCCAA
    TCCGTTCAGTAGGAACCGAT
    miRferno
    unknown protein
    21
    sbi-miR5384
    5.5
    chr4:8671043-8671060
    -
    ATGGTGGACTGCGACGCG
    GGCGACCTGCCGCCGCGC
    miRferno
    unknown protein
    22
    sbi-miR5384
    5
    chr4:8669917-8669934
    -
    CAGGTGACCGGCCGCGCG
    GGCGACCTGCCGCCGCGC
    miRferno
    unknown protein
    23
    sbi-miR5384
    5
    chr4:8670569-8670586
    -
    CAGCTGGCCGAAGGGGCG
    GGCGACCTGCCGCCGCGC
    miRferno
    unknown protein
    24
    sbi-miR1435b
    4
    chr4:8667576-8667595
    -
    AAATATTTTGACTTAAGTAA
    TTTTCCAAACTGAATTCTTT
    miRferno
    unknown protein
    25
    sbi-miR5565c
    4.0
    chr4:8667034-8667054
    -
    TCACCTTATTTCCCATTTGTA
    AGTGGAGTTAGGTGTACACAT
    miRferno
    unknown protein
    26
    sbi-miR1435a
    4
    chr4:8667576-8667595
    -
    AAATATTTTGACTTAAGTAA
    CTTTTCAAACTGAATTCTTT
    miRferno
    unknown protein
    27
    sbi-miR164b
    5
    chr7:3856674-3856694
    +
    AGCACTTTCCATCCTGCTCCA
    TCGTGCACGGGACGAAGAGGT
    miRferno
    unknown protein
    28
    sbi-miR437n;sbi-miR437m;sbi-miR437f;sbi-miR437g;sb
    1.0
    chr3:4222962-4222982
    +
    AAGTCAAACTTCTTTAGCTTT
    TTCAGTTTGAAGAGATTGAAA
    miRferno
    cobalt ion transmembrane transporter
    29
    sbi-miR5384
    2.0
    chr3:4217991-4218008
    +
    CTGTTGGACGCCGGCGCG
    GGCGACCTGCCGCCGCGC
    miRferno
    cobalt ion transmembrane transporter
    30
    sbi-miR5384
    4.5
    chr10:1681086-1681103
    -
    TCGCAGGACGTCGGCAAG
    GGCGACCTGCCGCCGCGC
    miRferno
    HIS1-3 (HISTONE H1-3); DNA binding / nucleosomal DNA binding