Search By Other

 Search
 for  
 In 
       ?

Sorghum bicolor miRNA Target Genome sites

Total 67744 records in 2259 Pages. Current page: 1
1/2259 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1
sbi-miR821e
5
chr1:1256796-1256816
-
CAACTTGAATTTTAATGAAAT
GTTGAAAATAAAACTACTGAA
miRferno
NRPB8B; DNA-directed RNA polymerase
2
sbi-miR1435b
4.5
chr1:1257748-1257767
-
AAAAAGTTTGACAAAGGTAA
TTTTCCAAACTGAATTCTTT
miRferno
NRPB8B; DNA-directed RNA polymerase
3
sbi-miR1435a
4.5
chr1:1257748-1257767
-
AAAAAGTTTGACAAAGGTAA
CTTTTCAAACTGAATTCTTT
miRferno
NRPB8B; DNA-directed RNA polymerase
4
sbi-miR5384
3.5
chr10:54070066-54070083
+
CCGCTGGATGGCGCCGGA
GGCGACCTGCCGCCGCGC
miRferno
HT1 (high leaf temperature 1); kinase/ protein serine/threonine/tyrosine kinase
5
sbi-miR5565e
5
chr4:57514054-57514072
+
TCCAACAACAACAACAAAA
AGGCTGTTGTAGGTTTGTT
miRferno
tetratricopeptide repeat (TPR)-containing protein
6
sbi-miR5384
5
chr4:57511696-57511713
+
GCCCAGGCCGGCGGCGGG
GGCGACCTGCCGCCGCGC
miRferno
tetratricopeptide repeat (TPR)-containing protein
7
sbi-miR5384
4
chr4:10645579-10645596
-
CAGCCGGACGGCGGCGAC
GGCGACCTGCCGCCGCGC
miRferno
zinc finger (C3HC4-type RING finger) family protein
8
sbi-miR5384
4.0
chr4:10645558-10645575
-
TCGCCGGACTGCGCCGTG
GGCGACCTGCCGCCGCGC
miRferno
zinc finger (C3HC4-type RING finger) family protein
9
sbi-miR172e
5
chr5:57128988-57129008
-
GTACAACAACACAAAGATTCA
CACGTCGTAGTAGTTCTAAGT
miRferno
GRF10 (GENERAL REGULATORY FACTOR 10); ATP binding / protein binding / protein phosphorylated amino acid binding
10
sbi-miR5564c-5p
5.5
chr5:57133152-57133172
-
ACTGCAGCTGTTCGATCACTG
CGACGTCGACAAGCTGCTTAA
miRferno
GRF10 (GENERAL REGULATORY FACTOR 10); ATP binding / protein binding / protein phosphorylated amino acid binding
11
sbi-miR5565b;sbi-miR5565a
3.0
chr5:44058996-44059019
-
GATTCACTTTAATCCATGTGTGTT
CTAAGCGGAGTTAGGTGTACACAA
miRferno
unknown protein
12
sbi-miR5565e
1
chr5:44058906-44058924
-
TCAGACAACATCCAAACAA
AGGCTGTTGTAGGTTTGTT
miRferno
unknown protein
13
sbi-miR5565g-3p
5.0
chr5:44058997-44059020
-
GGATTCACTTTAATCCATGTGTGT
CATAAGTAGAGTTAGGTGTACACA
miRferno
unknown protein
14
sbi-miR5384
4.5
chr5:44058587-44058604
-
CTGGTGAACGGCGGCCAG
GGCGACCTGCCGCCGCGC
miRferno
unknown protein
15
sbi-miR5565c
3.0
chr5:44058996-44059016
-
TCACTTTAATCCATGTGTGTT
AGTGGAGTTAGGTGTACACAT
miRferno
unknown protein
16
sbi-miR5565g-5p
4.0
chr5:44058925-44058948
-
TTAACACATGCGGATTGATATGAA
GGTTGTATACACCTAACTACACTT
miRferno
unknown protein
17
sbi-miR5565f
2.5
chr5:44058917-44058936
-
GATTGATATGAATCAGACAA
CTAACTATATTTAGGCTGAT
miRferno
unknown protein
18
sbi-miR172b
5
chr2:69070745-69070764
-
TACACCATCATGAAAATTAC
ACGTCGTAGTAGTTCTAAGG
miRferno
cathepsin B-like cysteine protease, putative
19
sbi-miR5570
4.5
chr4:8675393-8675413
-
TGATATACTGATTTGTAATGT
ACTGTACGACTAAACAGAAAA
miRferno
unknown protein
20
sbi-miR169d-5p
4.5
chr4:8667250-8667269
-
AGTCAAGTTATACTTGCCAA
TCCGTTCAGTAGGAACCGAT
miRferno
unknown protein
21
sbi-miR5384
5.5
chr4:8671043-8671060
-
ATGGTGGACTGCGACGCG
GGCGACCTGCCGCCGCGC
miRferno
unknown protein
22
sbi-miR5384
5
chr4:8669917-8669934
-
CAGGTGACCGGCCGCGCG
GGCGACCTGCCGCCGCGC
miRferno
unknown protein
23
sbi-miR5384
5
chr4:8670569-8670586
-
CAGCTGGCCGAAGGGGCG
GGCGACCTGCCGCCGCGC
miRferno
unknown protein
24
sbi-miR1435b
4
chr4:8667576-8667595
-
AAATATTTTGACTTAAGTAA
TTTTCCAAACTGAATTCTTT
miRferno
unknown protein
25
sbi-miR5565c
4.0
chr4:8667034-8667054
-
TCACCTTATTTCCCATTTGTA
AGTGGAGTTAGGTGTACACAT
miRferno
unknown protein
26
sbi-miR1435a
4
chr4:8667576-8667595
-
AAATATTTTGACTTAAGTAA
CTTTTCAAACTGAATTCTTT
miRferno
unknown protein
27
sbi-miR164b
5
chr7:3856674-3856694
+
AGCACTTTCCATCCTGCTCCA
TCGTGCACGGGACGAAGAGGT
miRferno
unknown protein
28
sbi-miR437n;sbi-miR437m;sbi-miR437f;sbi-miR437g;sb
1.0
chr3:4222962-4222982
+
AAGTCAAACTTCTTTAGCTTT
TTCAGTTTGAAGAGATTGAAA
miRferno
cobalt ion transmembrane transporter
29
sbi-miR5384
2.0
chr3:4217991-4218008
+
CTGTTGGACGCCGGCGCG
GGCGACCTGCCGCCGCGC
miRferno
cobalt ion transmembrane transporter
30
sbi-miR5384
4.5
chr10:1681086-1681103
-
TCGCAGGACGTCGGCAAG
GGCGACCTGCCGCCGCGC
miRferno
HIS1-3 (HISTONE H1-3); DNA binding / nucleosomal DNA binding
IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1/2259 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>