Search By Other

 Search
 for  
 In 
       ?

Solanum lycopersicum miRNA Target Genome sites

Total 21584 records in 720 Pages. Current page: 1
1/720 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    sly-miR1916
    5.5
    ch10:1200454-1200473
    +
    TTGATGGGATTAAGTGAATT
    AACTCCACAGATTCACTTTA
    miRferno
    Centrin 2 (Fragment) (Q4U4N2_PIG)
    2
    sly-miR477-3p
    4.5
    ch12:2316560-2316581
    +
    GTTGGCTATACCTACAAGAATT
    CAACAGAGTGGGATGTTCTTGA
    miRferno
    Serine/threonine-protein kinase 38 (B6U4A0_MAIZE)
    3
    sly-miR397
    5.5
    ch08:1219260-1219279
    +
    TCATCCACATTGGACTGAAT
    AGTAGTTGCGACGTGAGTTA
    miRferno
    Tsi1-interacting protein TSIP1 (Q9ZPJ0_TOBAC)
    4
    sly-miR9474-5p
    5
    ch03:68700450-68700471
    -
    CATCTTATTGTTCACTTCTAAA
    GTAAAATAAGTACTGAAGATGT
    miRferno
    High affinity sulfate transporter 2 (SUT2_STYHA)
    5
    sly-miR5303
    3.5
    ch08:60468247-60468267
    +
    GTTGCTCCGACTCTTAAAAAA
    CAACGAGCTTGAGAAGTTTTT
    miRferno
    Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1-like protein (A2I438_MACHI)
    6
    sly-miR5303
    5
    ch01:96998235-96998255
    -
    ATTAGTCCAACTCTTCAAAAT
    CAACGAGCTTGAGAAGTTTTT
    miRferno
    DNA-damage-inducible protein F (B4V9L8_9ACTO)
    7
    sly-miR9470-3p
    5.0
    ch01:97000602-97000621
    -
    GGTAAAATCATTGACCCGAA
    CGATTTTAGGTACTCGGTTT
    miRferno
    DNA-damage-inducible protein F (B4V9L8_9ACTO)
    8
    sly-miR396b
    5
    ch05:7079997-7080017
    -
    AAGTTCTAGAATGCTGGGACA
    TTCAAGTTCTTTCGACACCTT
    miRferno
    Serine/threonine kinase (C4Q3G8_SCHMA)
    9
    sly-miR1916
    4.5
    ch02:53497037-53497056
    -
    ATGAGTTGACTAATTGAGAT
    AACTCCACAGATTCACTTTA
    miRferno
    Mitochondrial porin (Voltage-dependent anion channel) outer membrane protein (C4R1Z2_PICPG)
    10
    sly-miR164b-3p
    5
    ch12:66498852-66498872
    -
    TTTGGAGAAGGAAAACAAAAG
    CAACCTCTTCCTCTTGTGCAC
    miRferno
    Ubiquitin-conjugating enzyme 31 (D7L699_ARALY)
    11
    sly-miR396b
    5
    ch02:50116363-50116383
    +
    AATTTGTAGAAAACTGTGAAA
    TTCAAGTTCTTTCGACACCTT
    miRferno
    Glutaredoxin family protein (D7LM49_ARALY)
    12
    sly-miR477-5p
    4.5
    ch12:3022268-3022288
    -
    GAAGCCTTTGAGAAAGAAACA
    CCTCGGGAACTCCCTCTCTGT
    miRferno
    At1g19680-like protein (Fragment) (Q3YI70_ARALY)
    13
    sly-miR1916
    5
    ch12:3022886-3022905
    -
    ATTAGTTGTCTAAATGAAAA
    AACTCCACAGATTCACTTTA
    miRferno
    At1g19680-like protein (Fragment) (Q3YI70_ARALY)
    14
    sly-miR1918
    5.5
    ch01:3014239-3014260
    +
    GAGAAGTGAAAACTCACCAAAA
    CTCTTAGCTTGAGAGTGGTTGT
    miRferno
    4-diphosphocytidyl-2-C-methyl-D-erythritol kinase (manually curated)
    15
    sly-miR396b
    3.5
    ch01:3016782-3016802
    +
    TTGTTCGAGAAAGCTTTGGAA
    TTCAAGTTCTTTCGACACCTT
    miRferno
    4-diphosphocytidyl-2-C-methyl-D-erythritol kinase (manually curated)
    16
    sly-miR396a-5p
    4.0
    ch01:3016782-3016802
    +
    TTGTTCGAGAAAGCTTTGGAA
    GTCAAGTTCTTTCGACACCTT
    miRferno
    4-diphosphocytidyl-2-C-methyl-D-erythritol kinase (manually curated)
    17
    sly-miR172a;sly-miR172b
    5
    ch01:89833097-89833117
    +
    AGGCATCCTCATCCACATTCT
    TACGTCGTAGTAGTTCTAAGA
    miRferno
    Formin 3 (D0QAN4_ARATH)
    18
    sly-miR396a-3p
    5.5
    ch01:77420979-77420999
    -
    CTCTACACAGCTTTCTTGAAG
    GAAGGGTGTCGAAATAACTTG
    miRferno
    Chromodomain-helicase-DNA-binding protein 1-like (CHD1L_DANRE)
    19
    sly-miR168a-3p
    4.5
    ch01:77415961-77415981
    -
    ATTCATTTGCTGCAGGGAAGA
    TAAGTCAACTACGTTCCGTCC
    miRferno
    Chromodomain-helicase-DNA-binding protein 1-like (CHD1L_DANRE)
    20
    sly-miR5304
    4.5
    ch01:77426581-77426601
    -
    GGCATGATTATGTAGGGTTGA
    CCCTACTCATACATCGTAACT
    miRferno
    Chromodomain-helicase-DNA-binding protein 1-like (CHD1L_DANRE)
    21
    sly-miR169b
    4.5
    ch01:97867361-97867381
    +
    CAGGTAAGTCATCGATGCCCA
    GTCCGTTCAGTAGGAACCGAT
    miRferno
    plasma membrane intrinsic protein 2.8 (manually curated)
    22
    sly-miR1917
    4.5
    ch05:62760585-62760605
    -
    ATTATATAAATCTTTATTAAT
    TGAAATCGTGAGAAATAATTA
    miRferno
    Endoglucanase 1 (B6U0J0_MAIZE)
    23
    sly-miR156d-5p
    4.5
    ch05:1686641-1686660
    -
    GTGCTCACTCTTTTGTGAGC
    CACGAGTGAGAGAAGACAGT
    miRferno
    Receptor like kinase, RLK
    24
    sly-miR9476-3p
    4.5
    ch04:58585685-58585705
    +
    GTTCTACTACTACATTTTTTT
    CCAGATCAGGACGTAGAAAAA
    miRferno
    Abscicic acid stress ripening 4 (manually curated)
    25
    sly-miR395a;sly-miR395b
    5.0
    ch03:944860-944881
    +
    GTAGTTTCCCCTTACACCTCAG
    CCTCAAGGGGGTTTGTGAAGTC
    miRferno
    Zinc finger transcription factor 23 (manually curated)
    26
    sly-miR482e-5p
    5.5
    ch03:945854-945874
    +
    ACTCTTTGCACCCCAATCAGA
    TTAGAAAGGTGGGGTGGGTGT
    miRferno
    Zinc finger transcription factor 23 (manually curated)
    27
    sly-miR1917
    5
    ch10:62405755-62405775
    -
    AGTTGAACACCCTTTATTAAA
    TGAAATCGTGAGAAATAATTA
    miRferno
    Metacaspase 7 (D7KWG9_ARALY)
    28
    sly-miR5303
    3.5
    ch08:2602279-2602299
    -
    GTTGCTCGGATTCTCGAAAGA
    CAACGAGCTTGAGAAGTTTTT
    miRferno
    Sumo ligase (B0W3U7_CULQU)
    29
    sly-miR156d-5p
    4.5
    ch08:2600028-2600047
    -
    GTACTAACTCTTTTCTGTGC
    CACGAGTGAGAGAAGACAGT
    miRferno
    Sumo ligase (B0W3U7_CULQU)
    30
    sly-miR164b-3p
    4
    ch01:514251-514271
    -
    ATTGGAGAAGGAAAAGAAGTG
    CAACCTCTTCCTCTTGTGCAC
    miRferno
    Calmodulin binding protein (B6U0B7_MAIZE)