Search By Other

 Search
 for  
 In 
       ?

Solanum lycopersicum miRNA Target Genome sites

Total 21584 records in 720 Pages. Current page: 1
1/720 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1
sly-miR1916
5.5
ch10:1200454-1200473
+
TTGATGGGATTAAGTGAATT
AACTCCACAGATTCACTTTA
miRferno
Centrin 2 (Fragment) (Q4U4N2_PIG)
2
sly-miR477-3p
4.5
ch12:2316560-2316581
+
GTTGGCTATACCTACAAGAATT
CAACAGAGTGGGATGTTCTTGA
miRferno
Serine/threonine-protein kinase 38 (B6U4A0_MAIZE)
3
sly-miR397
5.5
ch08:1219260-1219279
+
TCATCCACATTGGACTGAAT
AGTAGTTGCGACGTGAGTTA
miRferno
Tsi1-interacting protein TSIP1 (Q9ZPJ0_TOBAC)
4
sly-miR9474-5p
5
ch03:68700450-68700471
-
CATCTTATTGTTCACTTCTAAA
GTAAAATAAGTACTGAAGATGT
miRferno
High affinity sulfate transporter 2 (SUT2_STYHA)
5
sly-miR5303
3.5
ch08:60468247-60468267
+
GTTGCTCCGACTCTTAAAAAA
CAACGAGCTTGAGAAGTTTTT
miRferno
Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1-like protein (A2I438_MACHI)
6
sly-miR5303
5
ch01:96998235-96998255
-
ATTAGTCCAACTCTTCAAAAT
CAACGAGCTTGAGAAGTTTTT
miRferno
DNA-damage-inducible protein F (B4V9L8_9ACTO)
7
sly-miR9470-3p
5.0
ch01:97000602-97000621
-
GGTAAAATCATTGACCCGAA
CGATTTTAGGTACTCGGTTT
miRferno
DNA-damage-inducible protein F (B4V9L8_9ACTO)
8
sly-miR396b
5
ch05:7079997-7080017
-
AAGTTCTAGAATGCTGGGACA
TTCAAGTTCTTTCGACACCTT
miRferno
Serine/threonine kinase (C4Q3G8_SCHMA)
9
sly-miR1916
4.5
ch02:53497037-53497056
-
ATGAGTTGACTAATTGAGAT
AACTCCACAGATTCACTTTA
miRferno
Mitochondrial porin (Voltage-dependent anion channel) outer membrane protein (C4R1Z2_PICPG)
10
sly-miR164b-3p
5
ch12:66498852-66498872
-
TTTGGAGAAGGAAAACAAAAG
CAACCTCTTCCTCTTGTGCAC
miRferno
Ubiquitin-conjugating enzyme 31 (D7L699_ARALY)
11
sly-miR396b
5
ch02:50116363-50116383
+
AATTTGTAGAAAACTGTGAAA
TTCAAGTTCTTTCGACACCTT
miRferno
Glutaredoxin family protein (D7LM49_ARALY)
12
sly-miR477-5p
4.5
ch12:3022268-3022288
-
GAAGCCTTTGAGAAAGAAACA
CCTCGGGAACTCCCTCTCTGT
miRferno
At1g19680-like protein (Fragment) (Q3YI70_ARALY)
13
sly-miR1916
5
ch12:3022886-3022905
-
ATTAGTTGTCTAAATGAAAA
AACTCCACAGATTCACTTTA
miRferno
At1g19680-like protein (Fragment) (Q3YI70_ARALY)
14
sly-miR1918
5.5
ch01:3014239-3014260
+
GAGAAGTGAAAACTCACCAAAA
CTCTTAGCTTGAGAGTGGTTGT
miRferno
4-diphosphocytidyl-2-C-methyl-D-erythritol kinase (manually curated)
15
sly-miR396b
3.5
ch01:3016782-3016802
+
TTGTTCGAGAAAGCTTTGGAA
TTCAAGTTCTTTCGACACCTT
miRferno
4-diphosphocytidyl-2-C-methyl-D-erythritol kinase (manually curated)
16
sly-miR396a-5p
4.0
ch01:3016782-3016802
+
TTGTTCGAGAAAGCTTTGGAA
GTCAAGTTCTTTCGACACCTT
miRferno
4-diphosphocytidyl-2-C-methyl-D-erythritol kinase (manually curated)
17
sly-miR172a;sly-miR172b
5
ch01:89833097-89833117
+
AGGCATCCTCATCCACATTCT
TACGTCGTAGTAGTTCTAAGA
miRferno
Formin 3 (D0QAN4_ARATH)
18
sly-miR396a-3p
5.5
ch01:77420979-77420999
-
CTCTACACAGCTTTCTTGAAG
GAAGGGTGTCGAAATAACTTG
miRferno
Chromodomain-helicase-DNA-binding protein 1-like (CHD1L_DANRE)
19
sly-miR168a-3p
4.5
ch01:77415961-77415981
-
ATTCATTTGCTGCAGGGAAGA
TAAGTCAACTACGTTCCGTCC
miRferno
Chromodomain-helicase-DNA-binding protein 1-like (CHD1L_DANRE)
20
sly-miR5304
4.5
ch01:77426581-77426601
-
GGCATGATTATGTAGGGTTGA
CCCTACTCATACATCGTAACT
miRferno
Chromodomain-helicase-DNA-binding protein 1-like (CHD1L_DANRE)
21
sly-miR169b
4.5
ch01:97867361-97867381
+
CAGGTAAGTCATCGATGCCCA
GTCCGTTCAGTAGGAACCGAT
miRferno
plasma membrane intrinsic protein 2.8 (manually curated)
22
sly-miR1917
4.5
ch05:62760585-62760605
-
ATTATATAAATCTTTATTAAT
TGAAATCGTGAGAAATAATTA
miRferno
Endoglucanase 1 (B6U0J0_MAIZE)
23
sly-miR156d-5p
4.5
ch05:1686641-1686660
-
GTGCTCACTCTTTTGTGAGC
CACGAGTGAGAGAAGACAGT
miRferno
Receptor like kinase, RLK
24
sly-miR9476-3p
4.5
ch04:58585685-58585705
+
GTTCTACTACTACATTTTTTT
CCAGATCAGGACGTAGAAAAA
miRferno
Abscicic acid stress ripening 4 (manually curated)
25
sly-miR395a;sly-miR395b
5.0
ch03:944860-944881
+
GTAGTTTCCCCTTACACCTCAG
CCTCAAGGGGGTTTGTGAAGTC
miRferno
Zinc finger transcription factor 23 (manually curated)
26
sly-miR482e-5p
5.5
ch03:945854-945874
+
ACTCTTTGCACCCCAATCAGA
TTAGAAAGGTGGGGTGGGTGT
miRferno
Zinc finger transcription factor 23 (manually curated)
27
sly-miR1917
5
ch10:62405755-62405775
-
AGTTGAACACCCTTTATTAAA
TGAAATCGTGAGAAATAATTA
miRferno
Metacaspase 7 (D7KWG9_ARALY)
28
sly-miR5303
3.5
ch08:2602279-2602299
-
GTTGCTCGGATTCTCGAAAGA
CAACGAGCTTGAGAAGTTTTT
miRferno
Sumo ligase (B0W3U7_CULQU)
29
sly-miR156d-5p
4.5
ch08:2600028-2600047
-
GTACTAACTCTTTTCTGTGC
CACGAGTGAGAGAAGACAGT
miRferno
Sumo ligase (B0W3U7_CULQU)
30
sly-miR164b-3p
4
ch01:514251-514271
-
ATTGGAGAAGGAAAAGAAGTG
CAACCTCTTCCTCTTGTGCAC
miRferno
Calmodulin binding protein (B6U0B7_MAIZE)
IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1/720 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>