Search By Other

 Search
 for  
 In 
       ?

Zea mays miRNA Target Genome sites

Total 69332 records in 2312 Pages. Current page: 1
1/2312 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
    1
    zma-miR399i-5p
    5.5
    chr7:160049207-160049227
    +
    CATACCAGAGGAAACTCGCAA
    GTACGGTCTCCTCTCGGCGTG
    miRferno
    Villin-4
    2
    zma-miR159h-3p;zma-miR159i-3p
    4.5
    chr7:160045134-160045154
    +
    CAAATATCACTTCATTCCAAA
    GTCTCGAGGGAAGTGAGGTTT
    miRferno
    Villin-4
    3
    zma-miR156e-3p
    5.5
    chr7:160050434-160050455
    +
    GATGACAAAGGAAGCATTTAGC
    CTACTGTCTCTCTCGTCACTCG
    miRferno
    Villin-4
    4
    zma-miR159k-3p;zma-miR159b-3p;zma-miR159f-3p;zma-m
    5
    chr7:160045134-160045154
    +
    CAAATATCACTTCATTCCAAA
    GTCTCGAGGGAAGTTAGGTTT
    miRferno
    Villin-4
    5
    zma-miR159g-3p
    4.5
    chr7:160045134-160045154
    +
    CAAATATCACTTCATTCCAAA
    GTCTTGAGGGAAGTGAGGTTT
    miRferno
    Villin-4
    6
    zma-miR156j-5p
    5.0
    chr7:160050749-160050769
    +
    TTTCCTCTTTCCTTTCTGTCA
    ACACGAGAGAGAGAAGACAGT
    miRferno
    Villin-4
    7
    zma-miR168a-3p
    5
    chr7:160043163-160043182
    +
    TTCACTTTGAGAAAGGAGGT
    AAGTGAACCACGTTCCGCCC
    miRferno
    Villin-4
    8
    zma-miR171e-5p;zma-miR171d-5p
    5.5
    chr7:160050119-160050139
    +
    TCTGAGTCAGAGAAGCCAAAA
    AGACTCACTCGGCTCGGTTGT
    miRferno
    Villin-4
    9
    zma-miR399b-3p
    5
    chr2:223198292-223198312
    +
    CCCGACAGCTGTCCTTCCGCA
    GTCCTGTCGAGAGGAAACCGT
    miRferno
    AAA-type ATPase family protein
    10
    zma-miR399b-5p
    4.0
    chr2:223192290-223192310
    +
    TATACCAGAGGGGTGCTGCCC
    GTACGGTCTCCTCTCGACGTG
    miRferno
    AAA-type ATPase family protein
    11
    zma-miR2275d-5p
    3.5
    chr2:223203790-223203810
    +
    AGTTTTCTTCCGTTTAACTTT
    TCAAAAGAAAGGAGGTTGAGA
    miRferno
    AAA-type ATPase family protein
    12
    zma-miR168b-3p
    5.0
    chr2:223205330-223205349
    +
    TTGGTTTGATGCAATGCAGG
    AAGTGAACTACGTTCCGCCC
    miRferno
    AAA-type ATPase family protein
    13
    zma-miR159e-5p
    5
    chr1:151025706-151025726
    -
    TAACTGATGCTGCATTAGATG
    CTTGTCTACGACGTCCTCGAC
    miRferno
    Calmodulin-binding protein MPCBP
    14
    zma-miR167i-3p;zma-miR167h-3p
    5.0
    chr2:83942592-83942610
    -
    GTGTAGTAGTATCATGATC
    CACTTCGACGTTGTACTAG
    miRferno
    DnaJ protein ERDJ2A
    15
    zma-miR390b-3p;zma-miR390a-3p
    4.5
    chr2:83940140-83940160
    -
    TGAAGATCAGGAGAGATCGTG
    ACCTCGAGTCCTATCTATCGC
    miRferno
    DnaJ protein ERDJ2A
    16
    zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
    4.5
    chr2:83936811-83936828
    -
    CCAGCCAAAGGGACGGCG
    GATCGGTTCCTCTGACGG
    miRferno
    DnaJ protein ERDJ2A
    17
    zma-miR160f-5p
    4.5
    chr2:83936449-83936469
    -
    CGGCATACGTGCAGCCAGGGA
    GCCGTATGTCCCTCGGTCCGT
    miRferno
    DnaJ protein ERDJ2A
    18
    zma-miR160a-5p;zma-miR160e;zma-miR160g-5p;zma-miR1
    5.5
    chr2:83936449-83936469
    -
    CGGCATACGTGCAGCCAGGGA
    ACCGTATGTCCCTCGGTCCGT
    miRferno
    DnaJ protein ERDJ2A
    19
    zma-miR169q-3p
    4.0
    chr10:134656122-134656140
    -
    GGTGGCCAGAGGGCCAGCC
    GAATCGGTCTTCCGGACGG
    miRferno
    SH3 domain-containing protein 2
    20
    zma-miR169q-3p
    5.5
    chr5:179685314-179685332
    -
    CTCGGCGAGAACGCCAGCC
    GAATCGGTCTTCCGGACGG
    miRferno
    UDP-glycosyltransferase 85A7
    21
    zma-miR164d-3p
    5
    chr9:77035200-77035219
    +
    ATGAACAAGGATACATCGTG
    TACCTCTTCCTCTGGTGCAC
    miRferno
    Nuclear poly(A) polymerase 2
    22
    zma-miR169n-3p
    5.0
    chr9:77035038-77035057
    +
    GTTAGTCAAGGTGGCCTTCC
    GAATCGGTTCTTCCGGACGG
    miRferno
    Nuclear poly(A) polymerase 2
    23
    zma-miR160b-3p;zma-miR160g-3p
    4.5
    chr10:127561442-127561462
    +
    CATGCTTGGTGCATTGCACCC
    GTACGAACCGAGGAACGTGCG
    miRferno
    ATP-dependent DNA helicase Q-like 5
    24
    zma-miR160a-3p
    4.5
    chr10:127561442-127561462
    +
    CATGCTTGGTGCATTGCACCC
    GTACGAACCGGGGAACGTGCG
    miRferno
    ATP-dependent DNA helicase Q-like 5
    25
    zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
    5.5
    chr10:143879999-143880016
    +
    TCCGCCAAGAAGACGGCC
    GATCGGTTCCTCTGACGG
    miRferno
    60S ribosomal protein L27
    26
    zma-miR169k-5p;zma-miR169j-5p;zma-miR169i-5p
    5
    chr3:148890597-148890617
    -
    CAGTCATATCTTCCTTGGCTT
    GTCCGTTCAGTAGGAACCGAT
    miRferno
    Zea mays ARGOS6
    27
    zma-miR169l-5p
    4.5
    chr3:148890597-148890617
    -
    CAGTCATATCTTCCTTGGCTT
    GTCCGTTTAGTAGGGACCGAT
    miRferno
    Zea mays ARGOS6
    28
    zma-miR319b-3p;zma-miR319d-3p;zma-miR319c-3p;zma-m
    5
    chr3:148889779-148889798
    -
    ATAATCACCCTTCACTCCAA
    CCCTCGTGGGAAGTCAGGTT
    miRferno
    Zea mays ARGOS6
    29
    zma-miR172b-3p;zma-miR172c-3p;zma-miR172a;zma-miR1
    5.5
    chr3:148889398-148889417
    -
    AGCAACATCATCAGTACTCT
    ACGTCGTAGTAGTTCTAAGA
    miRferno
    Zea mays ARGOS6
    30
    zma-miR156b-5p;zma-miR156l-5p;zma-miR156d-5p;zma-m
    5
    chr3:93319767-93319786
    +
    CCGCTCCCTCTCCTCAGTCA
    CACGAGTGAGAGAAGACAGT
    miRferno
    DECUSSATE protein