Search By Other

 Search
 for  
 In 
       ?

Zea mays miRNA Target Genome sites

Total 69332 records in 2312 Pages. Current page: 1
1/2312 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1
zma-miR399i-5p
5.5
chr7:160049207-160049227
+
CATACCAGAGGAAACTCGCAA
GTACGGTCTCCTCTCGGCGTG
miRferno
Villin-4
2
zma-miR159h-3p;zma-miR159i-3p
4.5
chr7:160045134-160045154
+
CAAATATCACTTCATTCCAAA
GTCTCGAGGGAAGTGAGGTTT
miRferno
Villin-4
3
zma-miR156e-3p
5.5
chr7:160050434-160050455
+
GATGACAAAGGAAGCATTTAGC
CTACTGTCTCTCTCGTCACTCG
miRferno
Villin-4
4
zma-miR159k-3p;zma-miR159b-3p;zma-miR159f-3p;zma-m
5
chr7:160045134-160045154
+
CAAATATCACTTCATTCCAAA
GTCTCGAGGGAAGTTAGGTTT
miRferno
Villin-4
5
zma-miR159g-3p
4.5
chr7:160045134-160045154
+
CAAATATCACTTCATTCCAAA
GTCTTGAGGGAAGTGAGGTTT
miRferno
Villin-4
6
zma-miR156j-5p
5.0
chr7:160050749-160050769
+
TTTCCTCTTTCCTTTCTGTCA
ACACGAGAGAGAGAAGACAGT
miRferno
Villin-4
7
zma-miR168a-3p
5
chr7:160043163-160043182
+
TTCACTTTGAGAAAGGAGGT
AAGTGAACCACGTTCCGCCC
miRferno
Villin-4
8
zma-miR171e-5p;zma-miR171d-5p
5.5
chr7:160050119-160050139
+
TCTGAGTCAGAGAAGCCAAAA
AGACTCACTCGGCTCGGTTGT
miRferno
Villin-4
9
zma-miR399b-3p
5
chr2:223198292-223198312
+
CCCGACAGCTGTCCTTCCGCA
GTCCTGTCGAGAGGAAACCGT
miRferno
AAA-type ATPase family protein
10
zma-miR399b-5p
4.0
chr2:223192290-223192310
+
TATACCAGAGGGGTGCTGCCC
GTACGGTCTCCTCTCGACGTG
miRferno
AAA-type ATPase family protein
11
zma-miR2275d-5p
3.5
chr2:223203790-223203810
+
AGTTTTCTTCCGTTTAACTTT
TCAAAAGAAAGGAGGTTGAGA
miRferno
AAA-type ATPase family protein
12
zma-miR168b-3p
5.0
chr2:223205330-223205349
+
TTGGTTTGATGCAATGCAGG
AAGTGAACTACGTTCCGCCC
miRferno
AAA-type ATPase family protein
13
zma-miR159e-5p
5
chr1:151025706-151025726
-
TAACTGATGCTGCATTAGATG
CTTGTCTACGACGTCCTCGAC
miRferno
Calmodulin-binding protein MPCBP
14
zma-miR167i-3p;zma-miR167h-3p
5.0
chr2:83942592-83942610
-
GTGTAGTAGTATCATGATC
CACTTCGACGTTGTACTAG
miRferno
DnaJ protein ERDJ2A
15
zma-miR390b-3p;zma-miR390a-3p
4.5
chr2:83940140-83940160
-
TGAAGATCAGGAGAGATCGTG
ACCTCGAGTCCTATCTATCGC
miRferno
DnaJ protein ERDJ2A
16
zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
4.5
chr2:83936811-83936828
-
CCAGCCAAAGGGACGGCG
GATCGGTTCCTCTGACGG
miRferno
DnaJ protein ERDJ2A
17
zma-miR160f-5p
4.5
chr2:83936449-83936469
-
CGGCATACGTGCAGCCAGGGA
GCCGTATGTCCCTCGGTCCGT
miRferno
DnaJ protein ERDJ2A
18
zma-miR160a-5p;zma-miR160e;zma-miR160g-5p;zma-miR1
5.5
chr2:83936449-83936469
-
CGGCATACGTGCAGCCAGGGA
ACCGTATGTCCCTCGGTCCGT
miRferno
DnaJ protein ERDJ2A
19
zma-miR169q-3p
4.0
chr10:134656122-134656140
-
GGTGGCCAGAGGGCCAGCC
GAATCGGTCTTCCGGACGG
miRferno
SH3 domain-containing protein 2
20
zma-miR169q-3p
5.5
chr5:179685314-179685332
-
CTCGGCGAGAACGCCAGCC
GAATCGGTCTTCCGGACGG
miRferno
UDP-glycosyltransferase 85A7
21
zma-miR164d-3p
5
chr9:77035200-77035219
+
ATGAACAAGGATACATCGTG
TACCTCTTCCTCTGGTGCAC
miRferno
Nuclear poly(A) polymerase 2
22
zma-miR169n-3p
5.0
chr9:77035038-77035057
+
GTTAGTCAAGGTGGCCTTCC
GAATCGGTTCTTCCGGACGG
miRferno
Nuclear poly(A) polymerase 2
23
zma-miR160b-3p;zma-miR160g-3p
4.5
chr10:127561442-127561462
+
CATGCTTGGTGCATTGCACCC
GTACGAACCGAGGAACGTGCG
miRferno
ATP-dependent DNA helicase Q-like 5
24
zma-miR160a-3p
4.5
chr10:127561442-127561462
+
CATGCTTGGTGCATTGCACCC
GTACGAACCGGGGAACGTGCG
miRferno
ATP-dependent DNA helicase Q-like 5
25
zma-miR169i-3p;zma-miR169k-3p;zma-miR169j-3p
5.5
chr10:143879999-143880016
+
TCCGCCAAGAAGACGGCC
GATCGGTTCCTCTGACGG
miRferno
60S ribosomal protein L27
26
zma-miR169k-5p;zma-miR169j-5p;zma-miR169i-5p
5
chr3:148890597-148890617
-
CAGTCATATCTTCCTTGGCTT
GTCCGTTCAGTAGGAACCGAT
miRferno
Zea mays ARGOS6
27
zma-miR169l-5p
4.5
chr3:148890597-148890617
-
CAGTCATATCTTCCTTGGCTT
GTCCGTTTAGTAGGGACCGAT
miRferno
Zea mays ARGOS6
28
zma-miR319b-3p;zma-miR319d-3p;zma-miR319c-3p;zma-m
5
chr3:148889779-148889798
-
ATAATCACCCTTCACTCCAA
CCCTCGTGGGAAGTCAGGTT
miRferno
Zea mays ARGOS6
29
zma-miR172b-3p;zma-miR172c-3p;zma-miR172a;zma-miR1
5.5
chr3:148889398-148889417
-
AGCAACATCATCAGTACTCT
ACGTCGTAGTAGTTCTAAGA
miRferno
Zea mays ARGOS6
30
zma-miR156b-5p;zma-miR156l-5p;zma-miR156d-5p;zma-m
5
chr3:93319767-93319786
+
CCGCTCCCTCTCCTCAGTCA
CACGAGTGAGAGAAGACAGT
miRferno
DECUSSATE protein
IDMiRnameScoreGenomicSiteTarGeneStrandTarSeqmiRNASeqSoftwareSequence Description
1/2312 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>