Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Arabidopsis

Total 3860 records in 129 Pages. Current page: 1
1/129 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    ath-miR158a-3p
    3.0
    chr01:5942355-5942374|miR158a-3p|chr01:5942348-594
    AT1G17350
    +
    AltA
    Query:1TCCCAAATGTAGACAAAGCA20
    | | | | | * | | | * | : | | | | | | * |
    Sbjct:27AGGGTCTACTTTTGTTTCTT8
    TCCCAAATGTAGACAAAGCA
    psRobot
    AT1G17350|F28G4
    2
    ath-miR158a-3p
    3.0
    chr01:5942355-5942374|miR158a-3p|chr01:5942348-594
    AT1G17350
    +
    AltA
    Query:1TCCCAAATGTAGACAAAGCA20
    | | | | | * | | | * | : | | | | | | * |
    Sbjct:27AGGGTCTACTTTTGTTTCTT8
    TCCCAAATGTAGACAAAGCA
    psRobot
    AT1G17350|F28G4
    3
    ath-miR5021
    3.0
    chr03:572155-572175|miR5021|chr03:572142-572279
    AT3G02660
    -
    AltD
    Query:1TGAGAAGAAGAAGAAGAA-AA20
    * : | | | | | | | | | | | | * | | * * | |
    Sbjct:34CTTCTTCTTCTTCTACTACTT14
    TGAGAAGAAGAAGAAGAA-AA
    psRobot
    AT3G02660|EMB2768|FAC31|EMBRYO DEFECTIVE 2768|EMBRYONIC FACTOR 31|F16B3
    4
    ath-miR156j
    3.0
    chr04:8433371-8433390|miR156j|chr04:8433194-843346
    AT4G14720
    -
    AltD
    Query:1TGACAGAAGAGAGAGAGCAC20
    | | | | | * | | | | : | | | : | | * | *
    Sbjct:197ACTGTATTCTTTCTTTCTTT178
    TGACAGAAGAGAGAGAGCAC
    psRobot
    AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
    5
    ath-miR156j
    3.0
    chr04:8433218-8433237|miR156j|chr04:8433194-843331
    AT4G14720
    -
    ExonS
    Query:1TGACAGAAGAGAGAGAGCAC20
    | | | | | * | | | | : | | | : | | * | *
    Sbjct:44ACTGTATTCTTTCTTTCTTT25
    TGACAGAAGAGAGAGAGCAC
    psRobot
    AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
    6
    ath-miR156j
    3.0
    chr04:8433326-8433345|miR156j|chr04:8433194-843341
    AT4G14720
    -
    AltD
    Query:1TGACAGAAGAGAGAGAGCAC20
    | | | | | * | | | | : | | | : | | * | *
    Sbjct:152ACTGTATTCTTTCTTTCTTT133
    TGACAGAAGAGAGAGAGCAC
    psRobot
    AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
    7
    ath-miR156h
    2.5
    chr04:8433371-8433390|miR156h|chr04:8433194-843346
    AT4G14720
    -
    AltD
    Query:1TGACAGAAGAAAGAGAGCAC20
    | | | | | * | | | | | | | | : | | * | *
    Sbjct:197ACTGTATTCTTTCTTTCTTT178
    TGACAGAAGAAAGAGAGCAC
    psRobot
    AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
    8
    ath-miR156h
    2.5
    chr04:8433218-8433237|miR156h|chr04:8433194-843331
    AT4G14720
    -
    ExonS
    Query:1TGACAGAAGAAAGAGAGCAC20
    | | | | | * | | | | | | | | : | | * | *
    Sbjct:44ACTGTATTCTTTCTTTCTTT25
    TGACAGAAGAAAGAGAGCAC
    psRobot
    AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
    9
    ath-miR156h
    2.5
    chr04:8433326-8433345|miR156h|chr04:8433194-843341
    AT4G14720
    -
    AltD
    Query:1TGACAGAAGAAAGAGAGCAC20
    | | | | | * | | | | | | | | : | | * | *
    Sbjct:152ACTGTATTCTTTCTTTCTTT133
    TGACAGAAGAAAGAGAGCAC
    psRobot
    AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
    10
    ath-miR156i
    2.8
    chr04:8433371-8433390|miR156i|chr04:8433194-843346
    AT4G14720
    -
    AltD
    Query:1TGACAGAAGAGAGAGAGCAG20
    | | | | | * | | | | : | | | : | | * | :
    Sbjct:197ACTGTATTCTTTCTTTCTTT178
    TGACAGAAGAGAGAGAGCAG
    psRobot
    AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
    11
    ath-miR156i
    2.8
    chr04:8433218-8433237|miR156i|chr04:8433194-843331
    AT4G14720
    -
    ExonS
    Query:1TGACAGAAGAGAGAGAGCAG20
    | | | | | * | | | | : | | | : | | * | :
    Sbjct:44ACTGTATTCTTTCTTTCTTT25
    TGACAGAAGAGAGAGAGCAG
    psRobot
    AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
    12
    ath-miR156i
    2.8
    chr04:8433326-8433345|miR156i|chr04:8433194-843341
    AT4G14720
    -
    AltD
    Query:1TGACAGAAGAGAGAGAGCAG20
    | | | | | * | | | | : | | | : | | * | :
    Sbjct:152ACTGTATTCTTTCTTTCTTT133
    TGACAGAAGAGAGAGAGCAG
    psRobot
    AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
    13
    ath-miR156j
    3.0
    chr04:1869192-1869210|miR156j|chr04:1868942-186927
    AT4G03935
    -
    IntronR
    Query:1TGACAGAAGAGAGAGAGCAC20
    * | | * | | | | | | | | | | | | * | | *
    Sbjct:269TCTTTCTTCTCTCTCT-GTT251
    TGACAGAAGAGAGAGAGCAC
    psRobot
    AT4G03935
    14
    ath-miR156j
    3.0
    chr04:1869007-1869025|miR156j|chr04:1868942-186908
    AT4G03935
    -
    IntronR
    Query:1TGACAGAAGAGAGAGAGCAC20
    * | | * | | | | | | | | | | | | * | | *
    Sbjct:84TCTTTCTTCTCTCTCT-GTT66
    TGACAGAAGAGAGAGAGCAC
    psRobot
    AT4G03935
    15
    ath-miR156i
    2.8
    chr04:1869192-1869210|miR156i|chr04:1868942-186927
    AT4G03935
    -
    IntronR
    Query:1TGACAGAAGAGAGAGAGCAG20
    * | | * | | | | | | | | | | | | * | | :
    Sbjct:269TCTTTCTTCTCTCTCT-GTT251
    TGACAGAAGAGAGAGAGCAG
    psRobot
    AT4G03935
    16
    ath-miR156i
    2.8
    chr04:1869007-1869025|miR156i|chr04:1868942-186908
    AT4G03935
    -
    IntronR
    Query:1TGACAGAAGAGAGAGAGCAG20
    * | | * | | | | | | | | | | | | * | | :
    Sbjct:84TCTTTCTTCTCTCTCT-GTT66
    TGACAGAAGAGAGAGAGCAG
    psRobot
    AT4G03935
    17
    ath-miR164b-3p
    3.0
    chr03:19611238-19611258|miR164b-3p|chr03:19611200-
    AT3G52890
    +
    IntronR
    Query:1CATGTGCCCATCTTCACCATC21
    * | | | | | * | | | | | | | | | | * * * |
    Sbjct:59TTACACAGGTAGAAGTGCCTG39
    CATGTGCCCATCTTCACCATC
    psRobot
    AT3G52890|KIPK|KCBP-interacting protein kinase|F8J2
    18
    ath-miR164b-3p
    5
    chr03:19611238-19611258|miR164b-3p|chr03:19611200-
    AT3G52890
    +
    IntronR
    GTCCGTGAAGATGGACACATT

    CATGTGCCCATCTTCACCATC
    miRferno
    AT3G52890|KIPK|KCBP-interacting protein kinase|F8J2
    19
    ath-miR5021
    3.0
    chr05:24660265-24660284|miR5021|chr05:24660213-246
    AT5G61330
    -
    AltD
    Query:1TGAGAAGAAGAAGAAGAAAA20
    | : | : | | : | | : | | : | | : | | | |
    Sbjct:72ATTTTTTTTTTTTTTTTTTT53
    TGAGAAGAAGAAGAAGAAAA
    psRobot
    AT5G61330|MFB13
    20
    ath-miR5021
    3.0
    chr05:24660236-24660255|miR5021|chr05:24660213-246
    AT5G61330
    -
    AltD
    Query:1TGAGAAGAAGAAGAAGAAAA20
    | : | : | | : | | : | | : | | : | | | |
    Sbjct:43ATTTTTTTTTTTTTTTTTTT24
    TGAGAAGAAGAAGAAGAAAA
    psRobot
    AT5G61330|MFB13
    21
    ath-miR5652
    5.5
    chr01:12933035-12933055|miR5652|chr01:12932590-129
    AT1G35250
    -
    IntronR
    GGTCGATTGATCCACATTCTA

    TTGAATGTGAATGAATCGGGC
    miRferno
    AT1G35250|ALT2|acyl-lipid thioesterase 2|T9I1
    22
    ath-miR415
    3.0
    chr04:18078510-18078529|miR415|chr04:18078453-1807
    AT4G38710
    -
    ExonS
    Query:1AACAGAGCAGAAACAGAACAT21
    | | | | : | : | | | | | | * | | | * * | |
    Sbjct:77TTGTTTTGTCTTTCTCT-CTA58
    AACAGAGCAGAAACAGAACAT
    psRobot
    AT4G38710|T9A14
    23
    ath-miR860
    3.0
    chr05:3554108-3554127|miR860|chr05:3554101-3554236
    AT5G11170
    +
    AltA
    Query:1TCAATAGATTGGACTATGTAT21
    : | | | | | | | | | | : | * | | | * : * |
    Sbjct:27GGTTATCTAACTTTATA-GCA8
    TCAATAGATTGGACTATGTAT
    psRobot
    AT5G11170|UAP56a|homolog of human UAP56 a|F2I11
    24
    ath-miR860
    3.0
    chr05:3554108-3554127|miR860|chr05:3554101-3554171
    AT5G11170
    +
    AltA
    Query:1TCAATAGATTGGACTATGTAT21
    : | | | | | | | | | | : | * | | | * : * |
    Sbjct:27GGTTATCTAACTTTATA-GCA8
    TCAATAGATTGGACTATGTAT
    psRobot
    AT5G11170|UAP56a|homolog of human UAP56 a|F2I11
    25
    ath-miR855
    2.8
    chr02:8989648-8989669|miR855|chr02:8989511-8989817
    AT2G20900
    -
    IntronR
    Query:1AGCAAAAGCTAAGGAAAAGGAA22
    | : | | | | | | | * | | | : | | | | : | | *
    Sbjct:159TTGTTTTCGTTTCTTTTTTCTA138
    AGCAAAAGCTAAGGAAAAGGAA
    psRobot
    AT2G20900|DGK5|ATDGK5|diacylglycerol kinase 5|F5H14
    26
    ath-miR414
    2.8
    chr03:3942708-3942728|miR414|chr03:3942658-3942742
    AT3G12390
    +
    ExonS
    Query:1TCATCTTCATCATCATCGTCA21
    | | | | | : | * | | | | | | * | | : | | |
    Sbjct:71AGTAGGAATAGTAGCAGTAGT51
    TCATCTTCATCATCATCGTCA
    psRobot
    AT3G12390|T2E22
    27
    ath-miR414
    2.8
    chr03:3942708-3942728|miR414|chr03:3942667-3942742
    AT3G12390
    +
    ExonS
    Query:1TCATCTTCATCATCATCGTCA21
    | | | | | : | * | | | | | | * | | : | | |
    Sbjct:62AGTAGGAATAGTAGCAGTAGT42
    TCATCTTCATCATCATCGTCA
    psRobot
    AT3G12390|T2E22
    28
    ath-miR414
    3
    chr03:3942711-3942731|miR414|chr03:3942658-3942742
    AT3G12390
    +
    ExonS
    TGACGATGATAAGGATGATGA

    TCATCTTCATCATCATCGTCA
    miRferno
    AT3G12390|T2E22
    29
    ath-miR414
    3
    chr03:3942711-3942731|miR414|chr03:3942667-3942742
    AT3G12390
    +
    ExonS
    TGACGATGATAAGGATGATGA

    TCATCTTCATCATCATCGTCA
    miRferno
    AT3G12390|T2E22
    30
    ath-miR414
    4
    chr03:3942678-3942698|miR414|chr03:3942667-3942742
    AT3G12390
    +
    ExonS
    GGACGATGATGATAACGAAGA

    TCATCTTCATCATCATCGTCA
    miRferno
    AT3G12390|T2E22