Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Arabidopsis

Total 3860 records in 129 Pages. Current page: 1
1/129 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
ath-miR158a-3p
3.0
chr01:5942355-5942374|miR158a-3p|chr01:5942348-594
AT1G17350
+
AltA
Query:1TCCCAAATGTAGACAAAGCA20
| | | | | * | | | * | : | | | | | | * |
Sbjct:27AGGGTCTACTTTTGTTTCTT8
TCCCAAATGTAGACAAAGCA
psRobot
AT1G17350|F28G4
2
ath-miR158a-3p
3.0
chr01:5942355-5942374|miR158a-3p|chr01:5942348-594
AT1G17350
+
AltA
Query:1TCCCAAATGTAGACAAAGCA20
| | | | | * | | | * | : | | | | | | * |
Sbjct:27AGGGTCTACTTTTGTTTCTT8
TCCCAAATGTAGACAAAGCA
psRobot
AT1G17350|F28G4
3
ath-miR5021
3.0
chr03:572155-572175|miR5021|chr03:572142-572279
AT3G02660
-
AltD
Query:1TGAGAAGAAGAAGAAGAA-AA20
* : | | | | | | | | | | | | * | | * * | |
Sbjct:34CTTCTTCTTCTTCTACTACTT14
TGAGAAGAAGAAGAAGAA-AA
psRobot
AT3G02660|EMB2768|FAC31|EMBRYO DEFECTIVE 2768|EMBRYONIC FACTOR 31|F16B3
4
ath-miR156j
3.0
chr04:8433371-8433390|miR156j|chr04:8433194-843346
AT4G14720
-
AltD
Query:1TGACAGAAGAGAGAGAGCAC20
| | | | | * | | | | : | | | : | | * | *
Sbjct:197ACTGTATTCTTTCTTTCTTT178
TGACAGAAGAGAGAGAGCAC
psRobot
AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
5
ath-miR156j
3.0
chr04:8433218-8433237|miR156j|chr04:8433194-843331
AT4G14720
-
ExonS
Query:1TGACAGAAGAGAGAGAGCAC20
| | | | | * | | | | : | | | : | | * | *
Sbjct:44ACTGTATTCTTTCTTTCTTT25
TGACAGAAGAGAGAGAGCAC
psRobot
AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
6
ath-miR156j
3.0
chr04:8433326-8433345|miR156j|chr04:8433194-843341
AT4G14720
-
AltD
Query:1TGACAGAAGAGAGAGAGCAC20
| | | | | * | | | | : | | | : | | * | *
Sbjct:152ACTGTATTCTTTCTTTCTTT133
TGACAGAAGAGAGAGAGCAC
psRobot
AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
7
ath-miR156h
2.5
chr04:8433371-8433390|miR156h|chr04:8433194-843346
AT4G14720
-
AltD
Query:1TGACAGAAGAAAGAGAGCAC20
| | | | | * | | | | | | | | : | | * | *
Sbjct:197ACTGTATTCTTTCTTTCTTT178
TGACAGAAGAAAGAGAGCAC
psRobot
AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
8
ath-miR156h
2.5
chr04:8433218-8433237|miR156h|chr04:8433194-843331
AT4G14720
-
ExonS
Query:1TGACAGAAGAAAGAGAGCAC20
| | | | | * | | | | | | | | : | | * | *
Sbjct:44ACTGTATTCTTTCTTTCTTT25
TGACAGAAGAAAGAGAGCAC
psRobot
AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
9
ath-miR156h
2.5
chr04:8433326-8433345|miR156h|chr04:8433194-843341
AT4G14720
-
AltD
Query:1TGACAGAAGAAAGAGAGCAC20
| | | | | * | | | | | | | | : | | * | *
Sbjct:152ACTGTATTCTTTCTTTCTTT133
TGACAGAAGAAAGAGAGCAC
psRobot
AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
10
ath-miR156i
2.8
chr04:8433371-8433390|miR156i|chr04:8433194-843346
AT4G14720
-
AltD
Query:1TGACAGAAGAGAGAGAGCAG20
| | | | | * | | | | : | | | : | | * | :
Sbjct:197ACTGTATTCTTTCTTTCTTT178
TGACAGAAGAGAGAGAGCAG
psRobot
AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
11
ath-miR156i
2.8
chr04:8433218-8433237|miR156i|chr04:8433194-843331
AT4G14720
-
ExonS
Query:1TGACAGAAGAGAGAGAGCAG20
| | | | | * | | | | : | | | : | | * | :
Sbjct:44ACTGTATTCTTTCTTTCTTT25
TGACAGAAGAGAGAGAGCAG
psRobot
AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
12
ath-miR156i
2.8
chr04:8433326-8433345|miR156i|chr04:8433194-843341
AT4G14720
-
AltD
Query:1TGACAGAAGAGAGAGAGCAG20
| | | | | * | | | | : | | | : | | * | :
Sbjct:152ACTGTATTCTTTCTTTCTTT133
TGACAGAAGAGAGAGAGCAG
psRobot
AT4G14720|PPD2|TIFY4B|PEAPOD 2|DL3400C|FCAALL
13
ath-miR156j
3.0
chr04:1869192-1869210|miR156j|chr04:1868942-186927
AT4G03935
-
IntronR
Query:1TGACAGAAGAGAGAGAGCAC20
* | | * | | | | | | | | | | | | * | | *
Sbjct:269TCTTTCTTCTCTCTCT-GTT251
TGACAGAAGAGAGAGAGCAC
psRobot
AT4G03935
14
ath-miR156j
3.0
chr04:1869007-1869025|miR156j|chr04:1868942-186908
AT4G03935
-
IntronR
Query:1TGACAGAAGAGAGAGAGCAC20
* | | * | | | | | | | | | | | | * | | *
Sbjct:84TCTTTCTTCTCTCTCT-GTT66
TGACAGAAGAGAGAGAGCAC
psRobot
AT4G03935
15
ath-miR156i
2.8
chr04:1869192-1869210|miR156i|chr04:1868942-186927
AT4G03935
-
IntronR
Query:1TGACAGAAGAGAGAGAGCAG20
* | | * | | | | | | | | | | | | * | | :
Sbjct:269TCTTTCTTCTCTCTCT-GTT251
TGACAGAAGAGAGAGAGCAG
psRobot
AT4G03935
16
ath-miR156i
2.8
chr04:1869007-1869025|miR156i|chr04:1868942-186908
AT4G03935
-
IntronR
Query:1TGACAGAAGAGAGAGAGCAG20
* | | * | | | | | | | | | | | | * | | :
Sbjct:84TCTTTCTTCTCTCTCT-GTT66
TGACAGAAGAGAGAGAGCAG
psRobot
AT4G03935
17
ath-miR164b-3p
3.0
chr03:19611238-19611258|miR164b-3p|chr03:19611200-
AT3G52890
+
IntronR
Query:1CATGTGCCCATCTTCACCATC21
* | | | | | * | | | | | | | | | | * * * |
Sbjct:59TTACACAGGTAGAAGTGCCTG39
CATGTGCCCATCTTCACCATC
psRobot
AT3G52890|KIPK|KCBP-interacting protein kinase|F8J2
18
ath-miR164b-3p
5
chr03:19611238-19611258|miR164b-3p|chr03:19611200-
AT3G52890
+
IntronR
GTCCGTGAAGATGGACACATT

CATGTGCCCATCTTCACCATC
miRferno
AT3G52890|KIPK|KCBP-interacting protein kinase|F8J2
19
ath-miR5021
3.0
chr05:24660265-24660284|miR5021|chr05:24660213-246
AT5G61330
-
AltD
Query:1TGAGAAGAAGAAGAAGAAAA20
| : | : | | : | | : | | : | | : | | | |
Sbjct:72ATTTTTTTTTTTTTTTTTTT53
TGAGAAGAAGAAGAAGAAAA
psRobot
AT5G61330|MFB13
20
ath-miR5021
3.0
chr05:24660236-24660255|miR5021|chr05:24660213-246
AT5G61330
-
AltD
Query:1TGAGAAGAAGAAGAAGAAAA20
| : | : | | : | | : | | : | | : | | | |
Sbjct:43ATTTTTTTTTTTTTTTTTTT24
TGAGAAGAAGAAGAAGAAAA
psRobot
AT5G61330|MFB13
21
ath-miR5652
5.5
chr01:12933035-12933055|miR5652|chr01:12932590-129
AT1G35250
-
IntronR
GGTCGATTGATCCACATTCTA

TTGAATGTGAATGAATCGGGC
miRferno
AT1G35250|ALT2|acyl-lipid thioesterase 2|T9I1
22
ath-miR415
3.0
chr04:18078510-18078529|miR415|chr04:18078453-1807
AT4G38710
-
ExonS
Query:1AACAGAGCAGAAACAGAACAT21
| | | | : | : | | | | | | * | | | * * | |
Sbjct:77TTGTTTTGTCTTTCTCT-CTA58
AACAGAGCAGAAACAGAACAT
psRobot
AT4G38710|T9A14
23
ath-miR860
3.0
chr05:3554108-3554127|miR860|chr05:3554101-3554236
AT5G11170
+
AltA
Query:1TCAATAGATTGGACTATGTAT21
: | | | | | | | | | | : | * | | | * : * |
Sbjct:27GGTTATCTAACTTTATA-GCA8
TCAATAGATTGGACTATGTAT
psRobot
AT5G11170|UAP56a|homolog of human UAP56 a|F2I11
24
ath-miR860
3.0
chr05:3554108-3554127|miR860|chr05:3554101-3554171
AT5G11170
+
AltA
Query:1TCAATAGATTGGACTATGTAT21
: | | | | | | | | | | : | * | | | * : * |
Sbjct:27GGTTATCTAACTTTATA-GCA8
TCAATAGATTGGACTATGTAT
psRobot
AT5G11170|UAP56a|homolog of human UAP56 a|F2I11
25
ath-miR855
2.8
chr02:8989648-8989669|miR855|chr02:8989511-8989817
AT2G20900
-
IntronR
Query:1AGCAAAAGCTAAGGAAAAGGAA22
| : | | | | | | | * | | | : | | | | : | | *
Sbjct:159TTGTTTTCGTTTCTTTTTTCTA138
AGCAAAAGCTAAGGAAAAGGAA
psRobot
AT2G20900|DGK5|ATDGK5|diacylglycerol kinase 5|F5H14
26
ath-miR414
2.8
chr03:3942708-3942728|miR414|chr03:3942658-3942742
AT3G12390
+
ExonS
Query:1TCATCTTCATCATCATCGTCA21
| | | | | : | * | | | | | | * | | : | | |
Sbjct:71AGTAGGAATAGTAGCAGTAGT51
TCATCTTCATCATCATCGTCA
psRobot
AT3G12390|T2E22
27
ath-miR414
2.8
chr03:3942708-3942728|miR414|chr03:3942667-3942742
AT3G12390
+
ExonS
Query:1TCATCTTCATCATCATCGTCA21
| | | | | : | * | | | | | | * | | : | | |
Sbjct:62AGTAGGAATAGTAGCAGTAGT42
TCATCTTCATCATCATCGTCA
psRobot
AT3G12390|T2E22
28
ath-miR414
3
chr03:3942711-3942731|miR414|chr03:3942658-3942742
AT3G12390
+
ExonS
TGACGATGATAAGGATGATGA

TCATCTTCATCATCATCGTCA
miRferno
AT3G12390|T2E22
29
ath-miR414
3
chr03:3942711-3942731|miR414|chr03:3942667-3942742
AT3G12390
+
ExonS
TGACGATGATAAGGATGATGA

TCATCTTCATCATCATCGTCA
miRferno
AT3G12390|T2E22
30
ath-miR414
4
chr03:3942678-3942698|miR414|chr03:3942667-3942742
AT3G12390
+
ExonS
GGACGATGATGATAACGAAGA

TCATCTTCATCATCATCGTCA
miRferno
AT3G12390|T2E22
IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/129 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>