Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Eucalyptus grandis

Total 439 records in 15 Pages. Current page: 1
1/15 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
egr-miR-4988
5
Chr01:518828-518846|miR-4988|Chr01:518774-518865
Eucgr.A00240
-
AltA
TCACTGAAGTGAAATCGGT

ACCTATCACACTTCAGTCC
miRferno
Tetratricopeptide repeat (TPR)-like superfamily protein
2
egr-miR-4988
5
Chr01:16906277-16906295|miR-4988|Chr01:16906224-16
Eucgr.A00536
+
ExonS
TAACAGAAGTGTGAGAGGC

ACCTATCACACTTCAGTCC
miRferno
Mitochondrial substrate carrier family protein
3
egr-miR-4988
5
Chr01:16906277-16906295|miR-4988|Chr01:16906218-16
Eucgr.A00536
+
ExonS
TAACAGAAGTGTGAGAGGC

ACCTATCACACTTCAGTCC
miRferno
Mitochondrial substrate carrier family protein
4
egr-miR-4988
5
Chr01:12681641-12681659|miR-4988|Chr01:12680127-12
Eucgr.A00784
-
IntronR
TGACTGAATTGCCATAGCT

ACCTATCACACTTCAGTCC
miRferno
Mitochondrial ATP synthase D chain-related protein
5
egr-miR-4988
5
Chr01:12681641-12681659|miR-4988|Chr01:12680135-12
Eucgr.A00784
-
IntronR
TGACTGAATTGCCATAGCT

ACCTATCACACTTCAGTCC
miRferno
Mitochondrial ATP synthase D chain-related protein
6
egr-miR-4988
5
Chr01:12681641-12681659|miR-4988|Chr01:12680127-12
Eucgr.A00784
-
IntronR
TGACTGAATTGCCATAGCT

ACCTATCACACTTCAGTCC
miRferno
Mitochondrial ATP synthase D chain-related protein
7
egr-miR-4988
5
Chr01:12681641-12681659|miR-4988|Chr01:12680135-12
Eucgr.A00784
-
IntronR
TGACTGAATTGCCATAGCT

ACCTATCACACTTCAGTCC
miRferno
Mitochondrial ATP synthase D chain-related protein
8
egr-miR-71
4.5
Chr01:11705192-11705212|miR-71|Chr01:11704774-1170
Eucgr.A00872
-
IntronR
GATCACAACCATCTTCTTTCG

TGAAAGACGATGGTAGTGAGA
miRferno
Family of unknown function (DUF566)
9
egr-miR-1
3.0
Chr01:31028125-31028144|miR-1|Chr01:31028111-31028
Eucgr.A01088
+
IntronR
Query:1TGGAATGTTGTGAAGTATGT20
* | | | | : | : | | | * | | | | | * | |
Sbjct:34TCCTTGCGACAATTCATTCA15
TGGAATGTTGTGAAGTATGT
psRobot
centromere/kinetochore protein, putative (ZW10)
10
egr-miR-1
4.0
Chr01:31028125-31028144|miR-1|Chr01:31028111-31028
Eucgr.A01088
+
IntronR
ACTTACTTAACAGCGTTCCT

TGGAATGTTGTGAAGTATGT
miRferno
centromere/kinetochore protein, putative (ZW10)
11
egr-miR-1
5
Chr01:24095569-24095588|miR-1|Chr01:24095455-24097
Eucgr.A01196
+
IntronR
AGATCCTTCACCAAATTCAA

TGGAATGTTGTGAAGTATGT
miRferno
Ypt/Rab-GAP domain of gyp1p superfamily protein
12
egr-miR-1
5.0
Chr01:24096110-24096129|miR-1|Chr01:24095455-24097
Eucgr.A01196
+
IntronR
ACATCCATCGAAACATTCTA

TGGAATGTTGTGAAGTATGT
miRferno
Ypt/Rab-GAP domain of gyp1p superfamily protein
13
egr-miR-1
5
Chr01:24095569-24095588|miR-1|Chr01:24095455-24096
Eucgr.A01196
+
IntronR
AGATCCTTCACCAAATTCAA

TGGAATGTTGTGAAGTATGT
miRferno
Ypt/Rab-GAP domain of gyp1p superfamily protein
14
egr-miR-1
5.0
Chr01:24096110-24096129|miR-1|Chr01:24095455-24096
Eucgr.A01196
+
IntronR
ACATCCATCGAAACATTCTA

TGGAATGTTGTGAAGTATGT
miRferno
Ypt/Rab-GAP domain of gyp1p superfamily protein
15
egr-miR-71
4.5
Chr01:27123212-27123232|miR-71|Chr01:27123175-2712
Eucgr.A01591
+
IntronR
TCGAAATACCATCCTTTTTCA

TGAAAGACGATGGTAGTGAGA
miRferno
poly(A) binding protein 7
16
egr-miR-4988
4.5
Chr01:33087801-33087819|miR-4988|Chr01:33087681-33
Eucgr.A01810
+
IntronR
GAACTGAAATGTGGTCGGC

ACCTATCACACTTCAGTCC
miRferno
CAAX amino terminal protease family protein
17
egr-miR-4988
4.5
Chr01:33087801-33087819|miR-4988|Chr01:33087681-33
Eucgr.A01810
+
IntronR
GAACTGAAATGTGGTCGGC

ACCTATCACACTTCAGTCC
miRferno
CAAX amino terminal protease family protein
18
egr-miR-4988
4.5
Chr01:33087801-33087819|miR-4988|Chr01:33087681-33
Eucgr.A01810
+
IntronR
GAACTGAAATGTGGTCGGC

ACCTATCACACTTCAGTCC
miRferno
CAAX amino terminal protease family protein
19
egr-miR-87-3p
2.8
Chr01:35203185-35203204|miR-87-3p|Chr01:35203126-3
Eucgr.A01984
+
AltD
Query:1GTGAGCAAAGTTTCAGGTGT20
* | * | | | | | | | | | | | | | | * : *
Sbjct:79GAATCGTTTCAAAGTCCTTT60
GTGAGCAAAGTTTCAGGTGT
psRobot
Magnesium transporter CorA-like family protein
20
egr-miR-87-3p
5.5
Chr01:35203185-35203204|miR-87-3p|Chr01:35203126-3
Eucgr.A01984
+
AltD
TTTCCTGAAACTTTGCTAAG

GTGAGCAAAGTTTCAGGTGT
miRferno
Magnesium transporter CorA-like family protein
21
egr-miR-2c-3p
5
Chr01:35794493-35794512|miR-2c-3p|Chr01:35794228-3
Eucgr.A02036
-
IntronR
TTCATAAATATTGTGTCAGA

TCACAGCCAATATTGATGAA
miRferno
helicase in vascular tissue and tapetum
22
egr-miR-2c-3p
5
Chr01:35794493-35794512|miR-2c-3p|Chr01:35794228-3
Eucgr.A02036
-
IntronR
TTCATAAATATTGTGTCAGA

TCACAGCCAATATTGATGAA
miRferno
helicase in vascular tissue and tapetum
23
egr-miR-2c-3p
5
Chr01:35794493-35794512|miR-2c-3p|Chr01:35794228-3
Eucgr.A02036
-
IntronR
TTCATAAATATTGTGTCAGA

TCACAGCCAATATTGATGAA
miRferno
helicase in vascular tissue and tapetum
24
egr-miR-87-3p
3.0
Chr01:36883712-36883731|miR-87-3p|Chr01:36883703-3
Eucgr.A02154
-
AltA
Query:1GTGAGCAAAGTTTCAGGTGT20
| : | | | | | | | : | | : | * | | : | :
Sbjct:29CGCTCGTTTTAAGGACCGCG10
GTGAGCAAAGTTTCAGGTGT
psRobot
MATE efflux family protein
25
egr-miR-87-3p
3.0
Chr01:36883712-36883731|miR-87-3p|Chr01:36883703-3
Eucgr.A02154
-
AltA
Query:1GTGAGCAAAGTTTCAGGTGT20
| : | | | | | | | : | | : | * | | : | :
Sbjct:29CGCTCGTTTTAAGGACCGCG10
GTGAGCAAAGTTTCAGGTGT
psRobot
MATE efflux family protein
26
egr-miR-87-3p
5.0
Chr01:37789112-37789131|miR-87-3p|Chr01:37787996-3
Eucgr.A02240
-
IntronR
AGATCTGAAACTTTTCTTTC

GTGAGCAAAGTTTCAGGTGT
miRferno
TGACG motif-binding factor 6
27
egr-miR-1
5.5
Chr01:38035914-38035933|miR-1|Chr01:38035499-38036
Eucgr.A02263
+
IntronR
AAATTTTTCTCAACATTGCA

TGGAATGTTGTGAAGTATGT
miRferno
SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / D111/G-patch domain-containing protein
28
egr-miR-2c-3p
5.5
Chr01:38067701-38067720|miR-2c-3p|Chr01:38066803-3
Eucgr.A02268
-
IntronR
TTCGCCATTATTAGCTGTCA

TCACAGCCAATATTGATGAA
miRferno
Ankyrin repeat family protein / BTB/POZ domain-containing protein
29
egr-miR-2c-3p
5.5
Chr01:38067701-38067720|miR-2c-3p|Chr01:38066800-3
Eucgr.A02268
-
IntronR
TTCGCCATTATTAGCTGTCA

TCACAGCCAATATTGATGAA
miRferno
Ankyrin repeat family protein / BTB/POZ domain-containing protein
30
egr-miR-2c-3p
5.5
Chr01:38067701-38067720|miR-2c-3p|Chr01:38066770-3
Eucgr.A02268
-
IntronR
TTCGCCATTATTAGCTGTCA

TCACAGCCAATATTGATGAA
miRferno
Ankyrin repeat family protein / BTB/POZ domain-containing protein
IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/15 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>