Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Eucalyptus grandis

Total 439 records in 15 Pages. Current page: 1
1/15 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    egr-miR-4988
    5
    Chr01:518828-518846|miR-4988|Chr01:518774-518865
    Eucgr.A00240
    -
    AltA
    TCACTGAAGTGAAATCGGT

    ACCTATCACACTTCAGTCC
    miRferno
    Tetratricopeptide repeat (TPR)-like superfamily protein
    2
    egr-miR-4988
    5
    Chr01:16906277-16906295|miR-4988|Chr01:16906224-16
    Eucgr.A00536
    +
    ExonS
    TAACAGAAGTGTGAGAGGC

    ACCTATCACACTTCAGTCC
    miRferno
    Mitochondrial substrate carrier family protein
    3
    egr-miR-4988
    5
    Chr01:16906277-16906295|miR-4988|Chr01:16906218-16
    Eucgr.A00536
    +
    ExonS
    TAACAGAAGTGTGAGAGGC

    ACCTATCACACTTCAGTCC
    miRferno
    Mitochondrial substrate carrier family protein
    4
    egr-miR-4988
    5
    Chr01:12681641-12681659|miR-4988|Chr01:12680127-12
    Eucgr.A00784
    -
    IntronR
    TGACTGAATTGCCATAGCT

    ACCTATCACACTTCAGTCC
    miRferno
    Mitochondrial ATP synthase D chain-related protein
    5
    egr-miR-4988
    5
    Chr01:12681641-12681659|miR-4988|Chr01:12680135-12
    Eucgr.A00784
    -
    IntronR
    TGACTGAATTGCCATAGCT

    ACCTATCACACTTCAGTCC
    miRferno
    Mitochondrial ATP synthase D chain-related protein
    6
    egr-miR-4988
    5
    Chr01:12681641-12681659|miR-4988|Chr01:12680127-12
    Eucgr.A00784
    -
    IntronR
    TGACTGAATTGCCATAGCT

    ACCTATCACACTTCAGTCC
    miRferno
    Mitochondrial ATP synthase D chain-related protein
    7
    egr-miR-4988
    5
    Chr01:12681641-12681659|miR-4988|Chr01:12680135-12
    Eucgr.A00784
    -
    IntronR
    TGACTGAATTGCCATAGCT

    ACCTATCACACTTCAGTCC
    miRferno
    Mitochondrial ATP synthase D chain-related protein
    8
    egr-miR-71
    4.5
    Chr01:11705192-11705212|miR-71|Chr01:11704774-1170
    Eucgr.A00872
    -
    IntronR
    GATCACAACCATCTTCTTTCG

    TGAAAGACGATGGTAGTGAGA
    miRferno
    Family of unknown function (DUF566)
    9
    egr-miR-1
    3.0
    Chr01:31028125-31028144|miR-1|Chr01:31028111-31028
    Eucgr.A01088
    +
    IntronR
    Query:1TGGAATGTTGTGAAGTATGT20
    * | | | | : | : | | | * | | | | | * | |
    Sbjct:34TCCTTGCGACAATTCATTCA15
    TGGAATGTTGTGAAGTATGT
    psRobot
    centromere/kinetochore protein, putative (ZW10)
    10
    egr-miR-1
    4.0
    Chr01:31028125-31028144|miR-1|Chr01:31028111-31028
    Eucgr.A01088
    +
    IntronR
    ACTTACTTAACAGCGTTCCT

    TGGAATGTTGTGAAGTATGT
    miRferno
    centromere/kinetochore protein, putative (ZW10)
    11
    egr-miR-1
    5
    Chr01:24095569-24095588|miR-1|Chr01:24095455-24097
    Eucgr.A01196
    +
    IntronR
    AGATCCTTCACCAAATTCAA

    TGGAATGTTGTGAAGTATGT
    miRferno
    Ypt/Rab-GAP domain of gyp1p superfamily protein
    12
    egr-miR-1
    5.0
    Chr01:24096110-24096129|miR-1|Chr01:24095455-24097
    Eucgr.A01196
    +
    IntronR
    ACATCCATCGAAACATTCTA

    TGGAATGTTGTGAAGTATGT
    miRferno
    Ypt/Rab-GAP domain of gyp1p superfamily protein
    13
    egr-miR-1
    5
    Chr01:24095569-24095588|miR-1|Chr01:24095455-24096
    Eucgr.A01196
    +
    IntronR
    AGATCCTTCACCAAATTCAA

    TGGAATGTTGTGAAGTATGT
    miRferno
    Ypt/Rab-GAP domain of gyp1p superfamily protein
    14
    egr-miR-1
    5.0
    Chr01:24096110-24096129|miR-1|Chr01:24095455-24096
    Eucgr.A01196
    +
    IntronR
    ACATCCATCGAAACATTCTA

    TGGAATGTTGTGAAGTATGT
    miRferno
    Ypt/Rab-GAP domain of gyp1p superfamily protein
    15
    egr-miR-71
    4.5
    Chr01:27123212-27123232|miR-71|Chr01:27123175-2712
    Eucgr.A01591
    +
    IntronR
    TCGAAATACCATCCTTTTTCA

    TGAAAGACGATGGTAGTGAGA
    miRferno
    poly(A) binding protein 7
    16
    egr-miR-4988
    4.5
    Chr01:33087801-33087819|miR-4988|Chr01:33087681-33
    Eucgr.A01810
    +
    IntronR
    GAACTGAAATGTGGTCGGC

    ACCTATCACACTTCAGTCC
    miRferno
    CAAX amino terminal protease family protein
    17
    egr-miR-4988
    4.5
    Chr01:33087801-33087819|miR-4988|Chr01:33087681-33
    Eucgr.A01810
    +
    IntronR
    GAACTGAAATGTGGTCGGC

    ACCTATCACACTTCAGTCC
    miRferno
    CAAX amino terminal protease family protein
    18
    egr-miR-4988
    4.5
    Chr01:33087801-33087819|miR-4988|Chr01:33087681-33
    Eucgr.A01810
    +
    IntronR
    GAACTGAAATGTGGTCGGC

    ACCTATCACACTTCAGTCC
    miRferno
    CAAX amino terminal protease family protein
    19
    egr-miR-87-3p
    2.8
    Chr01:35203185-35203204|miR-87-3p|Chr01:35203126-3
    Eucgr.A01984
    +
    AltD
    Query:1GTGAGCAAAGTTTCAGGTGT20
    * | * | | | | | | | | | | | | | | * : *
    Sbjct:79GAATCGTTTCAAAGTCCTTT60
    GTGAGCAAAGTTTCAGGTGT
    psRobot
    Magnesium transporter CorA-like family protein
    20
    egr-miR-87-3p
    5.5
    Chr01:35203185-35203204|miR-87-3p|Chr01:35203126-3
    Eucgr.A01984
    +
    AltD
    TTTCCTGAAACTTTGCTAAG

    GTGAGCAAAGTTTCAGGTGT
    miRferno
    Magnesium transporter CorA-like family protein
    21
    egr-miR-2c-3p
    5
    Chr01:35794493-35794512|miR-2c-3p|Chr01:35794228-3
    Eucgr.A02036
    -
    IntronR
    TTCATAAATATTGTGTCAGA

    TCACAGCCAATATTGATGAA
    miRferno
    helicase in vascular tissue and tapetum
    22
    egr-miR-2c-3p
    5
    Chr01:35794493-35794512|miR-2c-3p|Chr01:35794228-3
    Eucgr.A02036
    -
    IntronR
    TTCATAAATATTGTGTCAGA

    TCACAGCCAATATTGATGAA
    miRferno
    helicase in vascular tissue and tapetum
    23
    egr-miR-2c-3p
    5
    Chr01:35794493-35794512|miR-2c-3p|Chr01:35794228-3
    Eucgr.A02036
    -
    IntronR
    TTCATAAATATTGTGTCAGA

    TCACAGCCAATATTGATGAA
    miRferno
    helicase in vascular tissue and tapetum
    24
    egr-miR-87-3p
    3.0
    Chr01:36883712-36883731|miR-87-3p|Chr01:36883703-3
    Eucgr.A02154
    -
    AltA
    Query:1GTGAGCAAAGTTTCAGGTGT20
    | : | | | | | | | : | | : | * | | : | :
    Sbjct:29CGCTCGTTTTAAGGACCGCG10
    GTGAGCAAAGTTTCAGGTGT
    psRobot
    MATE efflux family protein
    25
    egr-miR-87-3p
    3.0
    Chr01:36883712-36883731|miR-87-3p|Chr01:36883703-3
    Eucgr.A02154
    -
    AltA
    Query:1GTGAGCAAAGTTTCAGGTGT20
    | : | | | | | | | : | | : | * | | : | :
    Sbjct:29CGCTCGTTTTAAGGACCGCG10
    GTGAGCAAAGTTTCAGGTGT
    psRobot
    MATE efflux family protein
    26
    egr-miR-87-3p
    5.0
    Chr01:37789112-37789131|miR-87-3p|Chr01:37787996-3
    Eucgr.A02240
    -
    IntronR
    AGATCTGAAACTTTTCTTTC

    GTGAGCAAAGTTTCAGGTGT
    miRferno
    TGACG motif-binding factor 6
    27
    egr-miR-1
    5.5
    Chr01:38035914-38035933|miR-1|Chr01:38035499-38036
    Eucgr.A02263
    +
    IntronR
    AAATTTTTCTCAACATTGCA

    TGGAATGTTGTGAAGTATGT
    miRferno
    SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / D111/G-patch domain-containing protein
    28
    egr-miR-2c-3p
    5.5
    Chr01:38067701-38067720|miR-2c-3p|Chr01:38066803-3
    Eucgr.A02268
    -
    IntronR
    TTCGCCATTATTAGCTGTCA

    TCACAGCCAATATTGATGAA
    miRferno
    Ankyrin repeat family protein / BTB/POZ domain-containing protein
    29
    egr-miR-2c-3p
    5.5
    Chr01:38067701-38067720|miR-2c-3p|Chr01:38066800-3
    Eucgr.A02268
    -
    IntronR
    TTCGCCATTATTAGCTGTCA

    TCACAGCCAATATTGATGAA
    miRferno
    Ankyrin repeat family protein / BTB/POZ domain-containing protein
    30
    egr-miR-2c-3p
    5.5
    Chr01:38067701-38067720|miR-2c-3p|Chr01:38066770-3
    Eucgr.A02268
    -
    IntronR
    TTCGCCATTATTAGCTGTCA

    TCACAGCCAATATTGATGAA
    miRferno
    Ankyrin repeat family protein / BTB/POZ domain-containing protein