Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Glycine max

Total 18404 records in 614 Pages. Current page: 1
1/614 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
gma-miR156b
3.0
chr11:301778-301797|miR156b|chr11:301760-301831
GLYMA11G00640
+
IntronR
Query:1TGACAGAAGAGAGAGAGCACA21
| | | | | : | | | | : | | | : | : * | * |
Sbjct:38ACTGTTTTCTTTCTTTTAT-T19
TGACAGAAGAGAGAGAGCACA
psRobot
ATCHR12; ATP binding / DNA binding / helicase/ nucleic acid binding
2
gma-miR9722
2.8
chr2:44323831-44323851|miR9722|chr2:44323710-44324219
GLYMA02G39010
-
IntronR
Query:1TAATAGAGGGAAGAAGATGAA21
| | | : | | | : | | | | : | | : | * : | |
Sbjct:142ATTGTCTTCCTTTTTTTTTTT122
TAATAGAGGGAAGAAGATGAA
psRobot
glycosyl hydrolase family 3 protein
3
gma-miR9726
2.8
chr6:11247351-11247372|miR9726|chr6:11247252-11247719
GLYMA06G14290
-
IntronR
Query:1TATAGGCATTATTTTTTTCTTC22
* | | | * | | | | | | | | | | : | : | | | *
Sbjct:121CTATGCGTAATAAAAGAGGAAC100
TATAGGCATTATTTTTTTCTTC
psRobot
NTL9 (NAC transcription factor-like 9); transcription factor
4
gma-miR5559
3.0
chr17:37530578-37530597|miR5559|chr17:37529523-37530884
GLYMA17G33600
-
AltD
Query:1TACTTGGTGAATTGTTGGATC21
* * | | | | | | | | * | | | | | | | * | |
Sbjct:1075CGGAACCACTGAACAACC-AG1056
TACTTGGTGAATTGTTGGATC
psRobot
unknown protein
5
gma-miR5559
3.0
chr17:37529746-37529765|miR5559|chr17:37529586-37529989
GLYMA17G33600
-
IntronR
Query:1TACTTGGTGAATTGTTGGATC21
* * | | | | | | | | * | | | | | | | * | |
Sbjct:180CGGAACCACTGAACAACC-AG161
TACTTGGTGAATTGTTGGATC
psRobot
unknown protein
6
gma-miR5559
3.0
chr17:37529788-37529807|miR5559|chr17:37529628-37529989
GLYMA17G33600
-
IntronR
Query:1TACTTGGTGAATTGTTGGATC21
* * | | | | | | | | * | | | | | | | * | |
Sbjct:180CGGAACCACTGAACAACC-AG161
TACTTGGTGAATTGTTGGATC
psRobot
unknown protein
7
gma-miR9722
3.0
chr13:28105607-28105627|miR9722|chr13:28104581-28105724
GLYMA13G24780
+
IntronR
Query:1TAATAGAGGGAAGAAGATGAA21
* | | | | * | | | | | | | | | : | | * | *
Sbjct:1047TTTATGTCCCTTCTTTTAGTA1027
TAATAGAGGGAAGAAGATGAA
psRobot
EMB2001 (embryo defective 2001); GTP binding
8
gma-miR156e,gma-miR156d,gma-miR156c,gma-miR156m,gm
2.8
chr11:38132905-38132924|miR156e,miR156d,miR156c,miR156m,miR156l,miR156i,miR156j|chr11:38132567-38132932
GLYMA11G36800
+
IntronR
Query:1TTGACAGAAGATAGAGAGCAC21
| : : | | | : | | | | | | | | : | : * | |
Sbjct:358AGTTGTTTTCTATCTTTT-TG339
TTGACAGAAGATAGAGAGCAC
psRobot
DNA topoisomerase family protein
9
gma-miR156e,gma-miR156d,gma-miR156c,gma-miR156m,gm
2.8
chr11:38132905-38132924|miR156e,miR156d,miR156c,miR156m,miR156l,miR156i,miR156j|chr11:38132567-38132937
GLYMA11G36800
+
IntronR
Query:1TTGACAGAAGATAGAGAGCAC21
| : : | | | : | | | | | | | | : | : * | |
Sbjct:358AGTTGTTTTCTATCTTTT-TG339
TTGACAGAAGATAGAGAGCAC
psRobot
DNA topoisomerase family protein
10
gma-miR1508c
2.8
chr2:45078352-45078372|miR1508c|chr2:45078021-45078574
GLYMA02G39870
-
IntronR
Query:1TAGAAAGGGAAATAGCAGTTG21
| | | | * | : : | | | | | | | | | | : : :
Sbjct:352ATCTGTTTCTTTATCGTCGGT332
TAGAAAGGGAAATAGCAGTTG
psRobot
WRKY33; transcription factor
11
gma-miR4995
2.8
chr6:2572793-2572813|miR4995|chr6:2572583-2573476
GLYMA06G03670
+
AltA
Query:1AGGCAGTGGCTTGGTTAAGGG21
| : | | | : | | | | | | : | | | | * : : :
Sbjct:231TTCGTTACCGAATCAATATTT211
AGGCAGTGGCTTGGTTAAGGG
psRobot
JAC1 (J-DOMAIN PROTEIN REQUIRED FOR CHLOROPLAST ACCUMULATION RESPONSE 1); heat shock protein binding
12
gma-miR9726
3.0
chr3:42572312-42572333|miR9726|chr3:42571646-42572355
GLYMA03G35300
+
ExonS
Query:1TATAGGCATTATTTTTTTCTTC22
| | | * : | | | | | * | | | | | | * | | | |
Sbjct:688ATAGTCGTAACAAAAAACGAAG667
TATAGGCATTATTTTTTTCTTC
psRobot
unknown protein
13
gma-miR9726
3.0
chr3:42572312-42572333|miR9726|chr3:42571291-42572355
GLYMA03G35300
+
ExonS
Query:1TATAGGCATTATTTTTTTCTTC22
| | | * : | | | | | * | | | | | | * | | | |
Sbjct:1043ATAGTCGTAACAAAAAACGAAG1022
TATAGGCATTATTTTTTTCTTC
psRobot
unknown protein
14
gma-miR9726
3.0
chr3:42572312-42572333|miR9726|chr3:42571342-42572355
GLYMA03G35300
+
AltD
Query:1TATAGGCATTATTTTTTTCTTC22
| | | * : | | | | | * | | | | | | * | | | |
Sbjct:992ATAGTCGTAACAAAAAACGAAG971
TATAGGCATTATTTTTTTCTTC
psRobot
unknown protein
15
gma-miR2606a,gma-miR2606b
2.8
chr12:8613071-8613091|miR2606a,miR2606b|chr12:8612658-8613299
GLYMA12G10650
+
IntronR
Query:1AAAAGCACTTAAGGAACGGTA21
| | | | | * | | : | | | : | | | | * : | |
Sbjct:434TTTTCATGGATTTCTTGATAT414
AAAAGCACTTAAGGAACGGTA
psRobot
ATGLR3.4; intracellular ligand-gated ion channel
16
gma-miR171i-5p
3.0
chr12:10762811-10762830|miR171i-5p|chr12:10762789-10762927
GLYMA12G12530
-
AltD
Query:1ATAAGAAAGCAATGCTCAAA20
| | | | | | | | : | * | | | * | | | | *
Sbjct:42TATTCTTTTGATACTAGTTA23
ATAAGAAAGCAATGCTCAAA
psRobot
unknown protein
17
gma-miR167d,gma-miR167a,gma-miR167b
3.0
chr10:45565432-45565452|miR167d,miR167a,miR167b|chr10:45565234-45565704
GLYMA10G37610
+
AltA
Query:1TGAAGCTGCCAGCATGATCTA21
| | | | | | | | | * | | | * | | | * * | |
Sbjct:219ACTTCGACGTTCGCACTCTAT199
TGAAGCTGCCAGCATGATCTA
psRobot
FRO2 (FERRIC REDUCTION OXIDASE 2); ferric-chelate reductase
18
gma-miR5670a
3.0
chr7:3801640-3801661|miR5670a|chr7:3801490-3801708
GLYMA07G05130
-
IntronR
Query:1CATCATACCATATTTGCTTCAT22
* | | | | | * | | | | | | * | | | | | | | *
Sbjct:172TTAGTAGGGTATATACGAAGTT151
CATCATACCATATTTGCTTCAT
psRobot
ALAAT2 (ALANINE AMINOTRANSFERASE 2); ATP binding / L-alanine:2-oxoglutarate aminotransferase
19
gma-miR4995
3.0
chr18:6235514-6235533|miR4995|chr18:6235462-6236343
GLYMA18G07530
+
IntronR
Query:1AGGCAGTGGCTTGGTTAAGGG21
| : | | | : | | | | | | | | | * | * | | *
Sbjct:72TTCGTTACCGAACCATT-CCA53
AGGCAGTGGCTTGGTTAAGGG
psRobot
GIL1 (GRAVITROPIC IN THE LIGHT)
20
gma-miR1523a
3.0
chr8:16285291-16285310|miR1523a|chr8:16285228-16285670
GLYMA08G21440
+
IntronR
Query:1ATGGGATAAATGTGAGCTCA20
| | * : | | | | | | | | | : | | | | * *
Sbjct:83TAATCTATTTACATTCGAAC64
ATGGGATAAATGTGAGCTCA
psRobot
nucleotidyltransferase family protein
21
gma-miR4402
2.8
chr2:13687453-13687475|miR4402|chr2:13687278-13688930
GLYMA02G15180
+
AltD
Query:1ACATATTATGGGTCTCAGACGGAC24
* | | | | | | | | | | | * | | | | : * | * | | |
Sbjct:198CGTATAATACCCTGAGTTCG-CTG176
ACATATTATGGGTCTCAGACGGAC
psRobot
unknown protein
22
gma-miR4402
2.8
chr2:13687453-13687475|miR4402|chr2:13687278-13689700
GLYMA02G15180
+
IntronR
Query:1ACATATTATGGGTCTCAGACGGAC24
* | | | | | | | | | | | * | | | | : * | * | | |
Sbjct:198CGTATAATACCCTGAGTTCG-CTG176
ACATATTATGGGTCTCAGACGGAC
psRobot
unknown protein
23
gma-miR4402
2.8
chr2:13687453-13687475|miR4402|chr2:13687152-13688930
GLYMA02G15180
+
AltD
Query:1ACATATTATGGGTCTCAGACGGAC24
* | | | | | | | | | | | * | | | | : * | * | | |
Sbjct:324CGTATAATACCCTGAGTTCG-CTG302
ACATATTATGGGTCTCAGACGGAC
psRobot
unknown protein
24
gma-miR4402
2.8
chr2:13687453-13687475|miR4402|chr2:13687152-13689700
GLYMA02G15180
+
IntronR
Query:1ACATATTATGGGTCTCAGACGGAC24
* | | | | | | | | | | | * | | | | : * | * | | |
Sbjct:324CGTATAATACCCTGAGTTCG-CTG302
ACATATTATGGGTCTCAGACGGAC
psRobot
unknown protein
25
gma-miR1525
2.5
chr7:217141-217161|miR1525|chr7:216507-218246
GLYMA07G00490
-
IntronR
Query:1TGGGTTAATTAAGTTTTTAGT21
| : | * | | | | : | | | | | | | | : | : |
Sbjct:655ATCAAATTGATTCAAAAGTTA635
TGGGTTAATTAAGTTTTTAGT
psRobot
RAD23; damaged DNA binding
26
gma-miR1525
2.5
chr7:216457-216477|miR1525|chr7:215823-218246
GLYMA07G00490
-
IntronR
Query:1TGGGTTAATTAAGTTTTTAGT21
| : | * | | | | : | | | | | | | | : | : |
Sbjct:655ATCAAATTGATTCAAAAGTTA635
TGGGTTAATTAAGTTTTTAGT
psRobot
RAD23; damaged DNA binding
27
gma-miR5784
3.0
chr15:10568581-10568600|miR5784|chr15:10568493-10568659
GLYMA15G14000
+
ExonS
Query:1AATTAGCTAATGGTTAGCTAA21
| | | : | | | * | | | : | | | | | | * | *
Sbjct:108TTAGTCGTTTATCAATCG-TC89
AATTAGCTAATGGTTAGCTAA
psRobot
FAH1 (FATTY ACID HYDROXYLASE 1); catalytic/ fatty acid alpha-hydroxylase
28
gma-miR5784
3.0
chr15:10568581-10568600|miR5784|chr15:10568493-10568679
GLYMA15G14000
+
ExonS
Query:1AATTAGCTAATGGTTAGCTAA21
| | | : | | | * | | | : | | | | | | * | *
Sbjct:108TTAGTCGTTTATCAATCG-TC89
AATTAGCTAATGGTTAGCTAA
psRobot
FAH1 (FATTY ACID HYDROXYLASE 1); catalytic/ fatty acid alpha-hydroxylase
29
gma-miR2119
2.5
chr8:4548027-4548047|miR2119|chr8:4547953-4548752
GLYMA08G06390
+
ExonS
Query:1TCAAAGGGAGTTGTAGGGGAA21
| | | | | | | | | * : | | : | | | : : | |
Sbjct:95AGTTTCCCTAGACGTCCTTTT75
TCAAAGGGAGTTGTAGGGGAA
psRobot
TIR1 (TRANSPORT INHIBITOR RESPONSE 1); auxin binding / protein binding / ubiquitin-protein ligase
30
gma-miR5784
3.0
chr20:237223-237243|miR5784|chr20:236861-238431
GLYMA20G00450
+
IntronR
Query:1AATTAGCTAATGGTTAGCTAA21
* | | : | | | | | | | * : | : | | | | | |
Sbjct:383GTAGTCGATTAGTAGTCGATT363
AATTAGCTAATGGTTAGCTAA
psRobot
DNAJ heat shock N-terminal domain-containing protein
IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/614 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>