Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Oryza sativa

Total 9863 records in 329 Pages. Current page: 1
1/329 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
osa-miR5513
3.0
chr03:10649280-10649300|miR5513|chr03:10648512-106
LOC_Os03g19010
+
IntronR
Query:1TAACAAAGGACAACAGACTGA21
* | | | | | | | : | * * | | | | | | | | |
Sbjct:789TTTGTTTCTTAGTGTCTGACT769
TAACAAAGGACAACAGACTGA
psRobot
cellular component organization,cellular process,molecular_function,membrane,peroxisome,protein binding
2
osa-miR1861c
3.0
chr03:13880069-13880090|miR1861c|chr03:13880042-13
LOC_Os03g24380
+
ExonS
Query:1CGATCTTGTAGCAAGAACTGAG22
* | * | | | | | | * | | | | | | | | | | | *
Sbjct:49CCGAGAACAGCGTTCTTGACTA28
CGATCTTGTAGCAAGAACTGAG
psRobot
response to stress,biosynthetic process,protein modification process,cytosol,catalytic activity,metabolic process
3
osa-miR1861c
3.0
chr03:13880069-13880090|miR1861c|chr03:13880006-13
LOC_Os03g24380
+
ExonS
Query:1CGATCTTGTAGCAAGAACTGAG22
* | * | | | | | | * | | | | | | | | | | | *
Sbjct:85CCGAGAACAGCGTTCTTGACTA64
CGATCTTGTAGCAAGAACTGAG
psRobot
response to stress,biosynthetic process,protein modification process,cytosol,catalytic activity,metabolic process
4
osa-miR1872
3.0
chr07:1613807-1613829|miR1872|chr07:1613760-161385
LOC_Os07g03870
+
ExonS
Query:1GAACTGTAAGTCTGTGACGGGTAA24
* | | | | | | | | : | | | | | | * | : : | | * |
Sbjct:70ATTGACATTTAGACAC-GTTCAAT48
GAACTGTAAGTCTGTGACGGGTAA
psRobot
biological_process,metabolic process,cellular process,kinase activity,plasma membrane
5
osa-miR1872
3.0
chr07:1613807-1613829|miR1872|chr07:1613752-161385
LOC_Os07g03870
+
ExonS
Query:1GAACTGTAAGTCTGTGACGGGTAA24
* | | | | | | | | : | | | | | | * | : : | | * |
Sbjct:78ATTGACATTTAGACAC-GTTCAAT56
GAACTGTAAGTCTGTGACGGGTAA
psRobot
biological_process,metabolic process,cellular process,kinase activity,plasma membrane
6
osa-miR1850.2
2.8
chr03:21649380-21649399|miR1850.2|chr03:21649365-2
LOC_Os03g38970
-
AltA
Query:1TTGTGTGTGAACTAAACGTGG21
: | | | | | | | | | | * | | | | * | * | |
Sbjct:35GACACACACTTTATTT-CTCC16
TTGTGTGTGAACTAAACGTGG
psRobot
cytosol
7
osa-miR1850.2
2.5
chr03:14556858-14556878|miR1850.2|chr03:14556162-1
LOC_Os03g25480
-
IntronR
Query:1TTGTGTGTGAACTAAACGTGG21
| | | * | * | | | | | | | | | | | : : | |
Sbjct:717AACCCCCACTTGATTTGTGCC697
TTGTGTGTGAACTAAACGTGG
psRobot
cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
8
osa-miR1850.2
2.5
chr03:14556677-14556697|miR1850.2|chr03:14555898-1
LOC_Os03g25480
-
ExonS
Query:1TTGTGTGTGAACTAAACGTGG21
| | | * | * | | | | | | | | | | | : : | |
Sbjct:800AACCCCCACTTGATTTGTGCC780
TTGTGTGTGAACTAAACGTGG
psRobot
cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
9
osa-miR1850.2
2.5
chr03:14557282-14557302|miR1850.2|chr03:14556162-1
LOC_Os03g25480
-
IntronR
Query:1TTGTGTGTGAACTAAACGTGG21
| | | * | * | | | | | | | | | | | : : | |
Sbjct:1141AACCCCCACTTGATTTGTGCC1121
TTGTGTGTGAACTAAACGTGG
psRobot
cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
10
osa-miR1850.2
2.5
chr03:14557290-14557310|miR1850.2|chr03:14556170-1
LOC_Os03g25480
-
IntronR
Query:1TTGTGTGTGAACTAAACGTGG21
| | | * | * | | | | | | | | | | | : : | |
Sbjct:1141AACCCCCACTTGATTTGTGCC1121
TTGTGTGTGAACTAAACGTGG
psRobot
cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
11
osa-miR1850.2
2.5
chr03:14556859-14556879|miR1850.2|chr03:14556170-1
LOC_Os03g25480
-
IntronR
Query:1TTGTGTGTGAACTAAACGTGG21
| | | * | * | | | | | | | | | | | : : | |
Sbjct:710AACCCCCACTTGATTTGTGCC690
TTGTGTGTGAACTAAACGTGG
psRobot
cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
12
osa-miR1850.2
2.5
chr03:14556851-14556871|miR1850.2|chr03:14556162-1
LOC_Os03g25480
-
IntronR
Query:1TTGTGTGTGAACTAAACGTGG21
| | | * | * | | | | | | | | | | | : : | |
Sbjct:710AACCCCCACTTGATTTGTGCC690
TTGTGTGTGAACTAAACGTGG
psRobot
cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
13
osa-miR1850.2
2.5
chr03:14556482-14556502|miR1850.2|chr03:14556170-1
LOC_Os03g25480
-
IntronR
Query:1TTGTGTGTGAACTAAACGTGG21
| | | * | * | | | | | | | | | | | : : | |
Sbjct:333AACCCCCACTTGATTTGTGCC313
TTGTGTGTGAACTAAACGTGG
psRobot
cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
14
osa-miR1850.2
2.5
chr03:14556941-14556961|miR1850.2|chr03:14556162-1
LOC_Os03g25480
-
AltA
Query:1TTGTGTGTGAACTAAACGTGG21
| | | * | * | | | | | | | | | | | : : | |
Sbjct:800AACCCCCACTTGATTTGTGCC780
TTGTGTGTGAACTAAACGTGG
psRobot
cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
15
osa-miR1850.2
2.5
chr03:14556474-14556494|miR1850.2|chr03:14556162-1
LOC_Os03g25480
-
IntronR
Query:1TTGTGTGTGAACTAAACGTGG21
| | | * | * | | | | | | | | | | | : : | |
Sbjct:333AACCCCCACTTGATTTGTGCC313
TTGTGTGTGAACTAAACGTGG
psRobot
cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
16
osa-miR1850.2
2.5
chr03:14556586-14556606|miR1850.2|chr03:14555898-1
LOC_Os03g25480
-
AltD
Query:1TTGTGTGTGAACTAAACGTGG21
| | | * | * | | | | | | | | | | | : : | |
Sbjct:709AACCCCCACTTGATTTGTGCC689
TTGTGTGTGAACTAAACGTGG
psRobot
cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
17
osa-miR1850.2
2.5
chr03:14556949-14556969|miR1850.2|chr03:14556170-1
LOC_Os03g25480
-
AltA
Query:1TTGTGTGTGAACTAAACGTGG21
| | | * | * | | | | | | | | | | | : : | |
Sbjct:800AACCCCCACTTGATTTGTGCC780
TTGTGTGTGAACTAAACGTGG
psRobot
cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
18
osa-miR2905
1.2
chr01:7898976-7898996|miR2905|chr01:7898099-789909
LOC_Os01g14100
-
IntronR
Query:1TACATGTCAGTGACAAAGGCA21
: | | | | | | | | | | | | | | | | | * | *
Sbjct:898GTGTACAGTCACTGTTTCAGG878
TACATGTCAGTGACAAAGGCA
psRobot
transport,membrane,transporter activity,transport,membrane,transporter activity,transport,membrane,transporter activity
19
osa-miR1436
2.0
chr12:11166472-11166492|miR1436|chr12:11166441-111
LOC_Os12g19260
-
IntronR
Query:1ACATTATGGGACGGAGGGAGT21
| * | | | * | | | | | | | | | | | | | | |
Sbjct:52TATAAAACCCTGCCTCCCTCA32
ACATTATGGGACGGAGGGAGT
psRobot
mitochondrion
20
osa-miR1436
2.0
chr12:11166606-11166626|miR1436|chr12:11166441-111
LOC_Os12g19260
-
IntronR
Query:1ACATTATGGGACGGAGGGAGT21
| * | | | * | | | | | | | | | | | | | | |
Sbjct:186TATAAAACCCTGCCTCCCTCA166
ACATTATGGGACGGAGGGAGT
psRobot
mitochondrion
21
osa-miR166i-5p
3.0
chr12:25824122-25824141|miR166i-5p|chr12:25823955-
LOC_Os12g41710
-
IntronR
Query:1AATGCAGTTTGATCCAAGATC21
| | | : | | | | : | : | | | | | | * | * *
Sbjct:187TTATGTCAGATTAGGTT-TCT168
AATGCAGTTTGATCCAAGATC
psRobot
cellular_component,metabolic process,cellular process,kinase activity,protein modification process,cellular_component,metabolic process,cellular process,kinase activity,protein modification process,cellular_component,metabolic process,cellular process,kinase activity,protein modification process,cellular_component,metabolic process,cellular process,kinase activity,protein modification process
22
osa-miR812d,osa-miR812e,osa-miR812a,osa-miR812c,os
2.5
chr01:7473017-7473038|miR812d,miR812e,miR812a,miR8
LOC_Os01g13420
-
IntronR
Query:1GACGGACGGTTAAACGTTGGAC22
| | | | : | * | | | | | | | | | | | * | * |
Sbjct:1821CTGCTTTCCAATTTGCAAACAG1800
GACGGACGGTTAAACGTTGGAC
psRobot
membrane,vacuole,biological_process,binding
23
osa-miR2918
3.0
chr08:24596187-24596207|miR2918|chr08:24594589-245
LOC_Os08g38910
-
ExonS
Query:1ATCCGTGTTGTCTGCGCTTTA21
| | | | | : | | : | * | | | | | | : | : *
Sbjct:1619TAGGCGCAGCCGACGCGGAGG1599
ATCCGTGTTGTCTGCGCTTTA
psRobot
biological_process,cytosol,transferase activity,metabolic process,cellular process,biosynthetic process,secondary metabolic process,biological_process,cytosol,transferase activity,metabolic process,cellular process,biosynthetic process,secondary metabolic process,biological_process,cytosol,transferase activity,metabolic process,cellular process,biosynthetic process,secondary metabolic process,biological_process,cytosol,transferase activity,metabolic process,cellular process,biosynthetic process,secondary metabolic process
24
osa-miR395t
2.5
chr03:4953260-4953280|miR395t|chr03:4950518-495357
LOC_Os03g09930
-
ExonS
Query:1GTGAAGTGTTTGGGGAAACTC21
* | | | | | | | | | | | | | * * | | | | |
Sbjct:2763GACTTCACAAACCCACTTGAG2743
GTGAAGTGTTTGGGGAAACTC
psRobot
membrane,transport,cellular process,transporter activity,membrane,transport,cellular process,transporter activity
25
osa-miR395r,osa-miR395y,osa-miR395e,osa-miR395m,os
1.5
chr03:4953260-4953280|miR395r,miR395y,miR395e,miR3
LOC_Os03g09930
-
ExonS
Query:1GTGAAGTGTTTGGGGGAACTC21
* | | | | | | | | | | | | | * | | | | | |
Sbjct:2763GACTTCACAAACCCACTTGAG2743
GTGAAGTGTTTGGGGGAACTC
psRobot
membrane,transport,cellular process,transporter activity,membrane,transport,cellular process,transporter activity
26
osa-miR395w
2.5
chr03:4953260-4953280|miR395w|chr03:4950518-495357
LOC_Os03g09930
-
ExonS
Query:1GTGAAGTGTTTGGGGGATTCTC22
* | | | | | | | | | | | | | * | | * * | | |
Sbjct:2763GACTTCACAAACCCACT-TGAG2743
GTGAAGTGTTTGGGGGATTCTC
psRobot
membrane,transport,cellular process,transporter activity,membrane,transport,cellular process,transporter activity
27
osa-miR1436
3.0
chr06:9275002-9275022|miR1436|chr06:9274953-927524
LOC_Os06g16280
-
IntronR
Query:1ACATTATGGGACGGAGGGAGT21
| * | | | * | | | | | | : | | | | * | | |
Sbjct:70TATAAAACCCTGTCTCCGTCA50
ACATTATGGGACGGAGGGAGT
psRobot
transport,cellular process,nucleus,membrane,nuclear envelope,transporter activity,cellular component organization,binding,cytoplasm
28
osa-miR815a,osa-miR815c,osa-miR815b
3.0
chr01:4330708-4330727|miR815a,miR815c,miR815b|chr0
LOC_Os01g08700
-
IntronR
Query:1AAGGGGATTGAGGAGATTGGG21
| | | : * | | : | | | | | | : | | * | | |
Sbjct:176TTCTACTGACTCCTTTA-CCC157
AAGGGGATTGAGGAGATTGGG
psRobot
biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development,biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development,biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development,biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development,biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development,biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development,biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development
29
osa-miR2121a,osa-miR2121b
0.5
chr03:2836587-2836610|miR2121a,miR2121b|chr03:2835
LOC_Os03g05680
+
IntronR
Query:1AAAACGGAGCGGTCCATTAGCGCG24
| | | | | | | | | | | : | | | | | | | | | | | |
Sbjct:1220TTTTGCCTCGCTAGGTAATCGCGC1197
AAAACGGAGCGGTCCATTAGCGCG
psRobot
reproduction,response to abiotic stimulus,post-embryonic development,cellular component organization,anatomical structure morphogenesis,cell growth,nucleus,response to endogenous stimulus,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,protein modification process,sequence-specific DNA binding transcription factor activity
30
osa-miR2121a,osa-miR2121b
0.5
chr03:2836587-2836610|miR2121a,miR2121b|chr03:2835
LOC_Os03g05680
+
IntronR
Query:1AAAACGGAGCGGTCCATTAGCGCG24
| | | | | | | | | | | : | | | | | | | | | | | |
Sbjct:1190TTTTGCCTCGCTAGGTAATCGCGC1167
AAAACGGAGCGGTCCATTAGCGCG
psRobot
reproduction,response to abiotic stimulus,post-embryonic development,cellular component organization,anatomical structure morphogenesis,cell growth,nucleus,response to endogenous stimulus,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,protein modification process,sequence-specific DNA binding transcription factor activity
IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/329 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>