Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Oryza sativa

Total 9863 records in 329 Pages. Current page: 1
1/329 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    osa-miR5513
    3.0
    chr03:10649280-10649300|miR5513|chr03:10648512-106
    LOC_Os03g19010
    +
    IntronR
    Query:1TAACAAAGGACAACAGACTGA21
    * | | | | | | | : | * * | | | | | | | | |
    Sbjct:789TTTGTTTCTTAGTGTCTGACT769
    TAACAAAGGACAACAGACTGA
    psRobot
    cellular component organization,cellular process,molecular_function,membrane,peroxisome,protein binding
    2
    osa-miR1861c
    3.0
    chr03:13880069-13880090|miR1861c|chr03:13880042-13
    LOC_Os03g24380
    +
    ExonS
    Query:1CGATCTTGTAGCAAGAACTGAG22
    * | * | | | | | | * | | | | | | | | | | | *
    Sbjct:49CCGAGAACAGCGTTCTTGACTA28
    CGATCTTGTAGCAAGAACTGAG
    psRobot
    response to stress,biosynthetic process,protein modification process,cytosol,catalytic activity,metabolic process
    3
    osa-miR1861c
    3.0
    chr03:13880069-13880090|miR1861c|chr03:13880006-13
    LOC_Os03g24380
    +
    ExonS
    Query:1CGATCTTGTAGCAAGAACTGAG22
    * | * | | | | | | * | | | | | | | | | | | *
    Sbjct:85CCGAGAACAGCGTTCTTGACTA64
    CGATCTTGTAGCAAGAACTGAG
    psRobot
    response to stress,biosynthetic process,protein modification process,cytosol,catalytic activity,metabolic process
    4
    osa-miR1872
    3.0
    chr07:1613807-1613829|miR1872|chr07:1613760-161385
    LOC_Os07g03870
    +
    ExonS
    Query:1GAACTGTAAGTCTGTGACGGGTAA24
    * | | | | | | | | : | | | | | | * | : : | | * |
    Sbjct:70ATTGACATTTAGACAC-GTTCAAT48
    GAACTGTAAGTCTGTGACGGGTAA
    psRobot
    biological_process,metabolic process,cellular process,kinase activity,plasma membrane
    5
    osa-miR1872
    3.0
    chr07:1613807-1613829|miR1872|chr07:1613752-161385
    LOC_Os07g03870
    +
    ExonS
    Query:1GAACTGTAAGTCTGTGACGGGTAA24
    * | | | | | | | | : | | | | | | * | : : | | * |
    Sbjct:78ATTGACATTTAGACAC-GTTCAAT56
    GAACTGTAAGTCTGTGACGGGTAA
    psRobot
    biological_process,metabolic process,cellular process,kinase activity,plasma membrane
    6
    osa-miR1850.2
    2.8
    chr03:21649380-21649399|miR1850.2|chr03:21649365-2
    LOC_Os03g38970
    -
    AltA
    Query:1TTGTGTGTGAACTAAACGTGG21
    : | | | | | | | | | | * | | | | * | * | |
    Sbjct:35GACACACACTTTATTT-CTCC16
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cytosol
    7
    osa-miR1850.2
    2.5
    chr03:14556858-14556878|miR1850.2|chr03:14556162-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:717AACCCCCACTTGATTTGTGCC697
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    8
    osa-miR1850.2
    2.5
    chr03:14556677-14556697|miR1850.2|chr03:14555898-1
    LOC_Os03g25480
    -
    ExonS
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:800AACCCCCACTTGATTTGTGCC780
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    9
    osa-miR1850.2
    2.5
    chr03:14557282-14557302|miR1850.2|chr03:14556162-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:1141AACCCCCACTTGATTTGTGCC1121
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    10
    osa-miR1850.2
    2.5
    chr03:14557290-14557310|miR1850.2|chr03:14556170-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:1141AACCCCCACTTGATTTGTGCC1121
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    11
    osa-miR1850.2
    2.5
    chr03:14556859-14556879|miR1850.2|chr03:14556170-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:710AACCCCCACTTGATTTGTGCC690
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    12
    osa-miR1850.2
    2.5
    chr03:14556851-14556871|miR1850.2|chr03:14556162-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:710AACCCCCACTTGATTTGTGCC690
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    13
    osa-miR1850.2
    2.5
    chr03:14556482-14556502|miR1850.2|chr03:14556170-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:333AACCCCCACTTGATTTGTGCC313
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    14
    osa-miR1850.2
    2.5
    chr03:14556941-14556961|miR1850.2|chr03:14556162-1
    LOC_Os03g25480
    -
    AltA
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:800AACCCCCACTTGATTTGTGCC780
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    15
    osa-miR1850.2
    2.5
    chr03:14556474-14556494|miR1850.2|chr03:14556162-1
    LOC_Os03g25480
    -
    IntronR
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:333AACCCCCACTTGATTTGTGCC313
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    16
    osa-miR1850.2
    2.5
    chr03:14556586-14556606|miR1850.2|chr03:14555898-1
    LOC_Os03g25480
    -
    AltD
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:709AACCCCCACTTGATTTGTGCC689
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    17
    osa-miR1850.2
    2.5
    chr03:14556949-14556969|miR1850.2|chr03:14556170-1
    LOC_Os03g25480
    -
    AltA
    Query:1TTGTGTGTGAACTAAACGTGG21
    | | | * | * | | | | | | | | | | | : : | |
    Sbjct:800AACCCCCACTTGATTTGTGCC780
    TTGTGTGTGAACTAAACGTGG
    psRobot
    cell,molecular_function,binding,catalytic activity,metabolic process,oxygen binding
    18
    osa-miR2905
    1.2
    chr01:7898976-7898996|miR2905|chr01:7898099-789909
    LOC_Os01g14100
    -
    IntronR
    Query:1TACATGTCAGTGACAAAGGCA21
    : | | | | | | | | | | | | | | | | | * | *
    Sbjct:898GTGTACAGTCACTGTTTCAGG878
    TACATGTCAGTGACAAAGGCA
    psRobot
    transport,membrane,transporter activity,transport,membrane,transporter activity,transport,membrane,transporter activity
    19
    osa-miR1436
    2.0
    chr12:11166472-11166492|miR1436|chr12:11166441-111
    LOC_Os12g19260
    -
    IntronR
    Query:1ACATTATGGGACGGAGGGAGT21
    | * | | | * | | | | | | | | | | | | | | |
    Sbjct:52TATAAAACCCTGCCTCCCTCA32
    ACATTATGGGACGGAGGGAGT
    psRobot
    mitochondrion
    20
    osa-miR1436
    2.0
    chr12:11166606-11166626|miR1436|chr12:11166441-111
    LOC_Os12g19260
    -
    IntronR
    Query:1ACATTATGGGACGGAGGGAGT21
    | * | | | * | | | | | | | | | | | | | | |
    Sbjct:186TATAAAACCCTGCCTCCCTCA166
    ACATTATGGGACGGAGGGAGT
    psRobot
    mitochondrion
    21
    osa-miR166i-5p
    3.0
    chr12:25824122-25824141|miR166i-5p|chr12:25823955-
    LOC_Os12g41710
    -
    IntronR
    Query:1AATGCAGTTTGATCCAAGATC21
    | | | : | | | | : | : | | | | | | * | * *
    Sbjct:187TTATGTCAGATTAGGTT-TCT168
    AATGCAGTTTGATCCAAGATC
    psRobot
    cellular_component,metabolic process,cellular process,kinase activity,protein modification process,cellular_component,metabolic process,cellular process,kinase activity,protein modification process,cellular_component,metabolic process,cellular process,kinase activity,protein modification process,cellular_component,metabolic process,cellular process,kinase activity,protein modification process
    22
    osa-miR812d,osa-miR812e,osa-miR812a,osa-miR812c,os
    2.5
    chr01:7473017-7473038|miR812d,miR812e,miR812a,miR8
    LOC_Os01g13420
    -
    IntronR
    Query:1GACGGACGGTTAAACGTTGGAC22
    | | | | : | * | | | | | | | | | | | * | * |
    Sbjct:1821CTGCTTTCCAATTTGCAAACAG1800
    GACGGACGGTTAAACGTTGGAC
    psRobot
    membrane,vacuole,biological_process,binding
    23
    osa-miR2918
    3.0
    chr08:24596187-24596207|miR2918|chr08:24594589-245
    LOC_Os08g38910
    -
    ExonS
    Query:1ATCCGTGTTGTCTGCGCTTTA21
    | | | | | : | | : | * | | | | | | : | : *
    Sbjct:1619TAGGCGCAGCCGACGCGGAGG1599
    ATCCGTGTTGTCTGCGCTTTA
    psRobot
    biological_process,cytosol,transferase activity,metabolic process,cellular process,biosynthetic process,secondary metabolic process,biological_process,cytosol,transferase activity,metabolic process,cellular process,biosynthetic process,secondary metabolic process,biological_process,cytosol,transferase activity,metabolic process,cellular process,biosynthetic process,secondary metabolic process,biological_process,cytosol,transferase activity,metabolic process,cellular process,biosynthetic process,secondary metabolic process
    24
    osa-miR395t
    2.5
    chr03:4953260-4953280|miR395t|chr03:4950518-495357
    LOC_Os03g09930
    -
    ExonS
    Query:1GTGAAGTGTTTGGGGAAACTC21
    * | | | | | | | | | | | | | * * | | | | |
    Sbjct:2763GACTTCACAAACCCACTTGAG2743
    GTGAAGTGTTTGGGGAAACTC
    psRobot
    membrane,transport,cellular process,transporter activity,membrane,transport,cellular process,transporter activity
    25
    osa-miR395r,osa-miR395y,osa-miR395e,osa-miR395m,os
    1.5
    chr03:4953260-4953280|miR395r,miR395y,miR395e,miR3
    LOC_Os03g09930
    -
    ExonS
    Query:1GTGAAGTGTTTGGGGGAACTC21
    * | | | | | | | | | | | | | * | | | | | |
    Sbjct:2763GACTTCACAAACCCACTTGAG2743
    GTGAAGTGTTTGGGGGAACTC
    psRobot
    membrane,transport,cellular process,transporter activity,membrane,transport,cellular process,transporter activity
    26
    osa-miR395w
    2.5
    chr03:4953260-4953280|miR395w|chr03:4950518-495357
    LOC_Os03g09930
    -
    ExonS
    Query:1GTGAAGTGTTTGGGGGATTCTC22
    * | | | | | | | | | | | | | * | | * * | | |
    Sbjct:2763GACTTCACAAACCCACT-TGAG2743
    GTGAAGTGTTTGGGGGATTCTC
    psRobot
    membrane,transport,cellular process,transporter activity,membrane,transport,cellular process,transporter activity
    27
    osa-miR1436
    3.0
    chr06:9275002-9275022|miR1436|chr06:9274953-927524
    LOC_Os06g16280
    -
    IntronR
    Query:1ACATTATGGGACGGAGGGAGT21
    | * | | | * | | | | | | : | | | | * | | |
    Sbjct:70TATAAAACCCTGTCTCCGTCA50
    ACATTATGGGACGGAGGGAGT
    psRobot
    transport,cellular process,nucleus,membrane,nuclear envelope,transporter activity,cellular component organization,binding,cytoplasm
    28
    osa-miR815a,osa-miR815c,osa-miR815b
    3.0
    chr01:4330708-4330727|miR815a,miR815c,miR815b|chr0
    LOC_Os01g08700
    -
    IntronR
    Query:1AAGGGGATTGAGGAGATTGGG21
    | | | : * | | : | | | | | | : | | * | | |
    Sbjct:176TTCTACTGACTCCTTTA-CCC157
    AAGGGGATTGAGGAGATTGGG
    psRobot
    biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development,biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development,biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development,biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development,biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development,biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development,biological_process,nucleus,nucleoplasm,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,response to stress,response to abiotic stimulus,flower development,protein binding,reproduction,post-embryonic development
    29
    osa-miR2121a,osa-miR2121b
    0.5
    chr03:2836587-2836610|miR2121a,miR2121b|chr03:2835
    LOC_Os03g05680
    +
    IntronR
    Query:1AAAACGGAGCGGTCCATTAGCGCG24
    | | | | | | | | | | | : | | | | | | | | | | | |
    Sbjct:1220TTTTGCCTCGCTAGGTAATCGCGC1197
    AAAACGGAGCGGTCCATTAGCGCG
    psRobot
    reproduction,response to abiotic stimulus,post-embryonic development,cellular component organization,anatomical structure morphogenesis,cell growth,nucleus,response to endogenous stimulus,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,protein modification process,sequence-specific DNA binding transcription factor activity
    30
    osa-miR2121a,osa-miR2121b
    0.5
    chr03:2836587-2836610|miR2121a,miR2121b|chr03:2835
    LOC_Os03g05680
    +
    IntronR
    Query:1AAAACGGAGCGGTCCATTAGCGCG24
    | | | | | | | | | | | : | | | | | | | | | | | |
    Sbjct:1190TTTTGCCTCGCTAGGTAATCGCGC1167
    AAAACGGAGCGGTCCATTAGCGCG
    psRobot
    reproduction,response to abiotic stimulus,post-embryonic development,cellular component organization,anatomical structure morphogenesis,cell growth,nucleus,response to endogenous stimulus,biosynthetic process,nucleobase, nucleoside, nucleotide and nucleic acid metabolic process,protein modification process,sequence-specific DNA binding transcription factor activity