Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Picea abies

Total 115 records in 4 Pages. Current page: 1
1/4 1 2 3 4 Next> Last>>

IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
pab-miR3706
5.5
MA_10171241:5124-5143|miR3706|MA_10171241:3284-568
MA_10171241g0010
-
AltD
TCTGGTCCAATTCTCCTACA

TTTCGGAGAAATGGATAAGA
miRferno
serine arginine-rich splicing factor RS31-like [Elaeis guineensis]
2
pab-miR3706
5.5
MA_10171241:5124-5143|miR3706|MA_10171241:3622-568
MA_10171241g0010
-
IntronR
TCTGGTCCAATTCTCCTACA

TTTCGGAGAAATGGATAAGA
miRferno
serine arginine-rich splicing factor RS31-like [Elaeis guineensis]
3
pab-miR1863
5
MA_10219750:6933-6954|miR1863|MA_10219750:6340-792
MA_10219750g0010
-
ExonS
AAACTAACATTCTTTCCGAGCT

AGCTCTGATACCATGTTAGATT
miRferno
pentatricopeptide repeat-containing mitochondrial-like [Pyrus x bretschneideri]
4
pab-miR160a;pab-miR160b
4.5
MA_10425902:43770-43790|miR160a;pab-miR160b|MA_104
MA_10425902g0010
-
IntronR
TGGTATACAGGGTGCAAAGGA

TGCCTGGCTCCCTGTATGCCA
miRferno
-like membrane insertion isoform 1 [Theobroma cacao]
5
pab-miR482d
3.0
MA_10426739:2215-2235|miR482d|MA_10426739:2193-228
MA_10426739g0010
-
IntronR
Query:1GGCTTGCGAGGATAGGAAAAA21
| | | | : | * : | | | | | | | | | | | * *
Sbjct:43CCGAGCATTCCTATCCTTTCG23
GGCTTGCGAGGATAGGAAAAA
psRobot
Kinase domain-containing isoform 1 [Theobroma cacao]
6
pab-miR482d
5.0
MA_10426739:2238-2258|miR482d|MA_10426739:2193-228
MA_10426739g0010
-
IntronR
GCTTTCCTATCCTTACGAGCC

GGCTTGCGAGGATAGGAAAAA
miRferno
Kinase domain-containing isoform 1 [Theobroma cacao]
7
pab-miR3711
2.5
MA_10427824:18120-18139|miR3711|MA_10427824:18110-
MA_10427824g0010
+
IntronR
Query:1TGGCGCTAGAAGGAGGGCCT20
| | | | | | | | : | | | : * | | | | * |
Sbjct:30ACCGCGATTTTCTCCCCGTA11
TGGCGCTAGAAGGAGGGCCT
psRobot
2-succinylbenzoate-- chloroplastic peroxisomal
8
pab-miR3711
2.5
MA_10427824:18120-18139|miR3711|MA_10427824:18110-
MA_10427824g0010
+
AltD
Query:1TGGCGCTAGAAGGAGGGCCT20
| | | | | | | | : | | | : * | | | | * |
Sbjct:30ACCGCGATTTTCTCCCCGTA11
TGGCGCTAGAAGGAGGGCCT
psRobot
2-succinylbenzoate-- chloroplastic peroxisomal
9
pab-miR3711
4.0
MA_10427824:18120-18139|miR3711|MA_10427824:18110-
MA_10427824g0010
+
IntronR
ATGCCCCTCTTTTAGCGCCA

TGGCGCTAGAAGGAGGGCCT
miRferno
2-succinylbenzoate-- chloroplastic peroxisomal
10
pab-miR3711
4.0
MA_10427824:18120-18139|miR3711|MA_10427824:18110-
MA_10427824g0010
+
AltD
ATGCCCCTCTTTTAGCGCCA

TGGCGCTAGAAGGAGGGCCT
miRferno
2-succinylbenzoate-- chloroplastic peroxisomal
11
pab-miR3709b
2.8
MA_10433252:41171-41192|miR3709b|MA_10433252:41142
MA_10433252g0010
+
IntronR
Query:1TTTAAATGCCTTAAATTCCCGA22
: | | | | | * * | | | | | | | | | * | | | |
Sbjct:51GAATTTTGGGAATTTAACGGCT30
TTTAAATGCCTTAAATTCCCGA
psRobot
unknown
12
pab-miR3709b
3.5
MA_10433252:41171-41192|miR3709b|MA_10433252:41142
MA_10433252g0010
+
IntronR
TCGGCAATTTAAGGGTTTTAAG

TTTAAATGCCTTAAATTCCCGA
miRferno
unknown
13
pab-miR3709b
5
MA_10433252:41270-41291|miR3709b|MA_10433252:41142
MA_10433252g0010
+
IntronR
CCAGCAATTTAAGGGTTTTAAA

TTTAAATGCCTTAAATTCCCGA
miRferno
unknown
14
pab-miR482c
5.5
MA_10434796:6448-6469|miR482c|MA_10434796:6233-658
MA_10434796g0020
-
IntronR
GGGTTAGGTGGAATAGGAAAGA

TCTTTCCTACTCCTCCCATTCC
miRferno
TMV resistance N
15
pab-miR482b
5.5
MA_10434796:6448-6469|miR482b|MA_10434796:6233-658
MA_10434796g0020
-
IntronR
GGGTTAGGTGGAATAGGAAAGA

TCTTCCCTATTCCTCCCATTCC
miRferno
TMV resistance N
16
pab-miR3702
4
MA_10435903:18187-18207|miR3702|MA_10435903:18093-
MA_10435903g0010
-
IntronR
GCGAATATTGAGCAAGAGATT

AATCTCTTGGTGCTTATTCGC
miRferno
homeodomain-leucine zipper trancription factor HB-3 [Picea abies]
17
pab-miR3706
3.0
MA_10435948:27706-27724|miR3706|MA_10435948:27616-
MA_10435948g0010
+
IntronR
Query:1TTTCGGAGAAATGGATAAGA20
| | | | * : | | | | | * | | | | | * | |
Sbjct:109AAAGATTCTTTTCCTAT-CT91
TTTCGGAGAAATGGATAAGA
psRobot
[Physcomitrella patens]
18
pab-miR3706
3.0
MA_10435948:27706-27724|miR3706|MA_10435948:27675-
MA_10435948g0010
+
IntronR
Query:1TTTCGGAGAAATGGATAAGA20
| | | | * : | | | | | * | | | | | * | |
Sbjct:50AAAGATTCTTTTCCTAT-CT32
TTTCGGAGAAATGGATAAGA
psRobot
[Physcomitrella patens]
19
pab-miR3706
3.0
MA_10435948:27706-27724|miR3706|MA_10435948:27656-
MA_10435948g0010
+
IntronR
Query:1TTTCGGAGAAATGGATAAGA20
| | | | * : | | | | | * | | | | | * | |
Sbjct:69AAAGATTCTTTTCCTAT-CT51
TTTCGGAGAAATGGATAAGA
psRobot
[Physcomitrella patens]
20
pab-miR3706
6.0
MA_10435948:27705-27724|miR3706|MA_10435948:27656-
MA_10435948g0010
+
IntronR
TTCTATCCTTTTCTTAGAAA

TTTCGGAGAAATGGATAAGA
miRferno
[Physcomitrella patens]
21
pab-miR3706
6.0
MA_10435948:27705-27724|miR3706|MA_10435948:27616-
MA_10435948g0010
+
IntronR
TTCTATCCTTTTCTTAGAAA

TTTCGGAGAAATGGATAAGA
miRferno
[Physcomitrella patens]
22
pab-miR3706
6.0
MA_10435948:27705-27724|miR3706|MA_10435948:27675-
MA_10435948g0010
+
IntronR
TTCTATCCTTTTCTTAGAAA

TTTCGGAGAAATGGATAAGA
miRferno
[Physcomitrella patens]
23
pab-miR3708
5
MA_10436531:15245-15265|miR3708|MA_10436531:15195-
MA_10436531g0010
+
AltA
TCTACAAGATATGTTATTTGA

TCACACAACATTTCTCGTACA
miRferno
ABC transporter A family member 1
24
pab-miR396a
5
MA_10436593:35895-35915|miR396a|MA_10436593:35754-
MA_10436593g0010
+
IntronR
TAGTTCTAACAAGGTGTGGAT

TTCCACAGCTTTCTTGAACTA
miRferno
cyclin-dependent kinase F-4-like isoform X1 [Nelumbo nucifera]
25
pab-miR396a
5
MA_10436593:35895-35915|miR396a|MA_10436593:35754-
MA_10436593g0010
+
IntronR
TAGTTCTAACAAGGTGTGGAT

TTCCACAGCTTTCTTGAACTA
miRferno
cyclin-dependent kinase F-4-like isoform X1 [Nelumbo nucifera]
26
pab-miR3706
4.5
MA_10436712:22505-22524|miR3706|MA_10436712:22502-
MA_10436712g0010
-
IntronR
TCTTATGCATTTGACAGGAA

TTTCGGAGAAATGGATAAGA
miRferno
PREDICTED: uncharacterized protein LOC18434014 [Amborella trichopoda]
27
pab-miR3706
6.0
MA_10436977:13810-13829|miR3706|MA_10436977:13696-
MA_10436977g0010
+
ExonS
TTATATCCATTATTCAGAAA

TTTCGGAGAAATGGATAAGA
miRferno
PREDICTED: uncharacterized protein LOC104610279
28
pab-miR396a
3.0
MA_10437082:36725-36744|miR396a|MA_10437082:35347-
MA_10437082g0020
-
ExonS
Query:1TTCCACAGCTTTCTTGAACTA21
| | * | | | | | | | | | | | : : | | * * |
Sbjct:1398AACGTGTCGAAAGAGTTT-TT1379
TTCCACAGCTTTCTTGAACTA
psRobot
pre-mRNA-splicing factor SYF1
29
pab-miR396a
3.0
MA_10437082:36784-36803|miR396a|MA_10437082:35347-
MA_10437082g0020
-
ExonS
Query:1TTCCACAGCTTTCTTGAACTA21
| | * | | | | | | | | | | | : : | | * * |
Sbjct:1457AACGTGTCGAAAGAGTTT-TT1438
TTCCACAGCTTTCTTGAACTA
psRobot
pre-mRNA-splicing factor SYF1
30
pab-miR396a
5
MA_120420:27167-27187|miR396a|MA_120420:24631-2730
MA_120420g0020
+
ExonS
TACTTCAAGACATGTTTGGAA

TTCCACAGCTTTCTTGAACTA
miRferno
lysine-specific histone demethylase 1 homolog 3
IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/4 1 2 3 4 Next> Last>>