Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Picea abies

Total 115 records in 4 Pages. Current page: 1
1/4 1 2 3 4 Next> Last>>

  • IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    pab-miR3706
    5.5
    MA_10171241:5124-5143|miR3706|MA_10171241:3284-568
    MA_10171241g0010
    -
    AltD
    TCTGGTCCAATTCTCCTACA

    TTTCGGAGAAATGGATAAGA
    miRferno
    serine arginine-rich splicing factor RS31-like [Elaeis guineensis]
    2
    pab-miR3706
    5.5
    MA_10171241:5124-5143|miR3706|MA_10171241:3622-568
    MA_10171241g0010
    -
    IntronR
    TCTGGTCCAATTCTCCTACA

    TTTCGGAGAAATGGATAAGA
    miRferno
    serine arginine-rich splicing factor RS31-like [Elaeis guineensis]
    3
    pab-miR1863
    5
    MA_10219750:6933-6954|miR1863|MA_10219750:6340-792
    MA_10219750g0010
    -
    ExonS
    AAACTAACATTCTTTCCGAGCT

    AGCTCTGATACCATGTTAGATT
    miRferno
    pentatricopeptide repeat-containing mitochondrial-like [Pyrus x bretschneideri]
    4
    pab-miR160a;pab-miR160b
    4.5
    MA_10425902:43770-43790|miR160a;pab-miR160b|MA_104
    MA_10425902g0010
    -
    IntronR
    TGGTATACAGGGTGCAAAGGA

    TGCCTGGCTCCCTGTATGCCA
    miRferno
    -like membrane insertion isoform 1 [Theobroma cacao]
    5
    pab-miR482d
    3.0
    MA_10426739:2215-2235|miR482d|MA_10426739:2193-228
    MA_10426739g0010
    -
    IntronR
    Query:1GGCTTGCGAGGATAGGAAAAA21
    | | | | : | * : | | | | | | | | | | | * *
    Sbjct:43CCGAGCATTCCTATCCTTTCG23
    GGCTTGCGAGGATAGGAAAAA
    psRobot
    Kinase domain-containing isoform 1 [Theobroma cacao]
    6
    pab-miR482d
    5.0
    MA_10426739:2238-2258|miR482d|MA_10426739:2193-228
    MA_10426739g0010
    -
    IntronR
    GCTTTCCTATCCTTACGAGCC

    GGCTTGCGAGGATAGGAAAAA
    miRferno
    Kinase domain-containing isoform 1 [Theobroma cacao]
    7
    pab-miR3711
    2.5
    MA_10427824:18120-18139|miR3711|MA_10427824:18110-
    MA_10427824g0010
    +
    IntronR
    Query:1TGGCGCTAGAAGGAGGGCCT20
    | | | | | | | | : | | | : * | | | | * |
    Sbjct:30ACCGCGATTTTCTCCCCGTA11
    TGGCGCTAGAAGGAGGGCCT
    psRobot
    2-succinylbenzoate-- chloroplastic peroxisomal
    8
    pab-miR3711
    2.5
    MA_10427824:18120-18139|miR3711|MA_10427824:18110-
    MA_10427824g0010
    +
    AltD
    Query:1TGGCGCTAGAAGGAGGGCCT20
    | | | | | | | | : | | | : * | | | | * |
    Sbjct:30ACCGCGATTTTCTCCCCGTA11
    TGGCGCTAGAAGGAGGGCCT
    psRobot
    2-succinylbenzoate-- chloroplastic peroxisomal
    9
    pab-miR3711
    4.0
    MA_10427824:18120-18139|miR3711|MA_10427824:18110-
    MA_10427824g0010
    +
    IntronR
    ATGCCCCTCTTTTAGCGCCA

    TGGCGCTAGAAGGAGGGCCT
    miRferno
    2-succinylbenzoate-- chloroplastic peroxisomal
    10
    pab-miR3711
    4.0
    MA_10427824:18120-18139|miR3711|MA_10427824:18110-
    MA_10427824g0010
    +
    AltD
    ATGCCCCTCTTTTAGCGCCA

    TGGCGCTAGAAGGAGGGCCT
    miRferno
    2-succinylbenzoate-- chloroplastic peroxisomal
    11
    pab-miR3709b
    2.8
    MA_10433252:41171-41192|miR3709b|MA_10433252:41142
    MA_10433252g0010
    +
    IntronR
    Query:1TTTAAATGCCTTAAATTCCCGA22
    : | | | | | * * | | | | | | | | | * | | | |
    Sbjct:51GAATTTTGGGAATTTAACGGCT30
    TTTAAATGCCTTAAATTCCCGA
    psRobot
    unknown
    12
    pab-miR3709b
    3.5
    MA_10433252:41171-41192|miR3709b|MA_10433252:41142
    MA_10433252g0010
    +
    IntronR
    TCGGCAATTTAAGGGTTTTAAG

    TTTAAATGCCTTAAATTCCCGA
    miRferno
    unknown
    13
    pab-miR3709b
    5
    MA_10433252:41270-41291|miR3709b|MA_10433252:41142
    MA_10433252g0010
    +
    IntronR
    CCAGCAATTTAAGGGTTTTAAA

    TTTAAATGCCTTAAATTCCCGA
    miRferno
    unknown
    14
    pab-miR482c
    5.5
    MA_10434796:6448-6469|miR482c|MA_10434796:6233-658
    MA_10434796g0020
    -
    IntronR
    GGGTTAGGTGGAATAGGAAAGA

    TCTTTCCTACTCCTCCCATTCC
    miRferno
    TMV resistance N
    15
    pab-miR482b
    5.5
    MA_10434796:6448-6469|miR482b|MA_10434796:6233-658
    MA_10434796g0020
    -
    IntronR
    GGGTTAGGTGGAATAGGAAAGA

    TCTTCCCTATTCCTCCCATTCC
    miRferno
    TMV resistance N
    16
    pab-miR3702
    4
    MA_10435903:18187-18207|miR3702|MA_10435903:18093-
    MA_10435903g0010
    -
    IntronR
    GCGAATATTGAGCAAGAGATT

    AATCTCTTGGTGCTTATTCGC
    miRferno
    homeodomain-leucine zipper trancription factor HB-3 [Picea abies]
    17
    pab-miR3706
    3.0
    MA_10435948:27706-27724|miR3706|MA_10435948:27616-
    MA_10435948g0010
    +
    IntronR
    Query:1TTTCGGAGAAATGGATAAGA20
    | | | | * : | | | | | * | | | | | * | |
    Sbjct:109AAAGATTCTTTTCCTAT-CT91
    TTTCGGAGAAATGGATAAGA
    psRobot
    [Physcomitrella patens]
    18
    pab-miR3706
    3.0
    MA_10435948:27706-27724|miR3706|MA_10435948:27675-
    MA_10435948g0010
    +
    IntronR
    Query:1TTTCGGAGAAATGGATAAGA20
    | | | | * : | | | | | * | | | | | * | |
    Sbjct:50AAAGATTCTTTTCCTAT-CT32
    TTTCGGAGAAATGGATAAGA
    psRobot
    [Physcomitrella patens]
    19
    pab-miR3706
    3.0
    MA_10435948:27706-27724|miR3706|MA_10435948:27656-
    MA_10435948g0010
    +
    IntronR
    Query:1TTTCGGAGAAATGGATAAGA20
    | | | | * : | | | | | * | | | | | * | |
    Sbjct:69AAAGATTCTTTTCCTAT-CT51
    TTTCGGAGAAATGGATAAGA
    psRobot
    [Physcomitrella patens]
    20
    pab-miR3706
    6.0
    MA_10435948:27705-27724|miR3706|MA_10435948:27656-
    MA_10435948g0010
    +
    IntronR
    TTCTATCCTTTTCTTAGAAA

    TTTCGGAGAAATGGATAAGA
    miRferno
    [Physcomitrella patens]
    21
    pab-miR3706
    6.0
    MA_10435948:27705-27724|miR3706|MA_10435948:27616-
    MA_10435948g0010
    +
    IntronR
    TTCTATCCTTTTCTTAGAAA

    TTTCGGAGAAATGGATAAGA
    miRferno
    [Physcomitrella patens]
    22
    pab-miR3706
    6.0
    MA_10435948:27705-27724|miR3706|MA_10435948:27675-
    MA_10435948g0010
    +
    IntronR
    TTCTATCCTTTTCTTAGAAA

    TTTCGGAGAAATGGATAAGA
    miRferno
    [Physcomitrella patens]
    23
    pab-miR3708
    5
    MA_10436531:15245-15265|miR3708|MA_10436531:15195-
    MA_10436531g0010
    +
    AltA
    TCTACAAGATATGTTATTTGA

    TCACACAACATTTCTCGTACA
    miRferno
    ABC transporter A family member 1
    24
    pab-miR396a
    5
    MA_10436593:35895-35915|miR396a|MA_10436593:35754-
    MA_10436593g0010
    +
    IntronR
    TAGTTCTAACAAGGTGTGGAT

    TTCCACAGCTTTCTTGAACTA
    miRferno
    cyclin-dependent kinase F-4-like isoform X1 [Nelumbo nucifera]
    25
    pab-miR396a
    5
    MA_10436593:35895-35915|miR396a|MA_10436593:35754-
    MA_10436593g0010
    +
    IntronR
    TAGTTCTAACAAGGTGTGGAT

    TTCCACAGCTTTCTTGAACTA
    miRferno
    cyclin-dependent kinase F-4-like isoform X1 [Nelumbo nucifera]
    26
    pab-miR3706
    4.5
    MA_10436712:22505-22524|miR3706|MA_10436712:22502-
    MA_10436712g0010
    -
    IntronR
    TCTTATGCATTTGACAGGAA

    TTTCGGAGAAATGGATAAGA
    miRferno
    PREDICTED: uncharacterized protein LOC18434014 [Amborella trichopoda]
    27
    pab-miR3706
    6.0
    MA_10436977:13810-13829|miR3706|MA_10436977:13696-
    MA_10436977g0010
    +
    ExonS
    TTATATCCATTATTCAGAAA

    TTTCGGAGAAATGGATAAGA
    miRferno
    PREDICTED: uncharacterized protein LOC104610279
    28
    pab-miR396a
    3.0
    MA_10437082:36725-36744|miR396a|MA_10437082:35347-
    MA_10437082g0020
    -
    ExonS
    Query:1TTCCACAGCTTTCTTGAACTA21
    | | * | | | | | | | | | | | : : | | * * |
    Sbjct:1398AACGTGTCGAAAGAGTTT-TT1379
    TTCCACAGCTTTCTTGAACTA
    psRobot
    pre-mRNA-splicing factor SYF1
    29
    pab-miR396a
    3.0
    MA_10437082:36784-36803|miR396a|MA_10437082:35347-
    MA_10437082g0020
    -
    ExonS
    Query:1TTCCACAGCTTTCTTGAACTA21
    | | * | | | | | | | | | | | : : | | * * |
    Sbjct:1457AACGTGTCGAAAGAGTTT-TT1438
    TTCCACAGCTTTCTTGAACTA
    psRobot
    pre-mRNA-splicing factor SYF1
    30
    pab-miR396a
    5
    MA_120420:27167-27187|miR396a|MA_120420:24631-2730
    MA_120420g0020
    +
    ExonS
    TACTTCAAGACATGTTTGGAA

    TTCCACAGCTTTCTTGAACTA
    miRferno
    lysine-specific histone demethylase 1 homolog 3