Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Bamboo

Total 5331 records in 178 Pages. Current page: 1
1/178 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    phe-miR2673a
    2.0
    PH01000000:3920111-3920128|miR2673a|PH01000000:3920006-3920227
    PH01000000G6020
    -
    IntronR
    Query:1GGAAGAGGAAGAGGAAGAG19
    * | * | | | | | | | | | | | | | | * |
    Sbjct:123ACATCTCCTTCTCCTTC-C106
    GGAAGAGGAAGAGGAAGAG
    psRobot
    aquaporin [Oryza sativa Japonica Group]
    2
    phe-miR1850.1
    2.8
    PH01000001:91810-91830|miR1850.1|PH01000001:91237-91925
    PH01000001G0140
    -
    IntronR
    Query:1TGGAAAGTTGGGAGATTGGGG21
    * | : | | | | | | | | : | | | : | : | * |
    Sbjct:594TCTTTTCAACCTTCTGATCAC574
    TGGAAAGTTGGGAGATTGGGG
    psRobot
    uncharacterized membrane At1g16860-like
    3
    phe-miR1850.1
    2.8
    PH01000001:91770-91790|miR1850.1|PH01000001:91197-91925
    PH01000001G0140
    -
    IntronR
    Query:1TGGAAAGTTGGGAGATTGGGG21
    * | : | | | | | | | | : | | | : | : | * |
    Sbjct:594TCTTTTCAACCTTCTGATCAC574
    TGGAAAGTTGGGAGATTGGGG
    psRobot
    uncharacterized membrane At1g16860-like
    4
    phe-miR845a-3p
    2.2
    PH01000002:2868409-2868429|miR845a-3p|PH01000002:2868114-2869609
    PH01000002G4300
    +
    IntronR
    Query:1CGGCTCTGATACCAGTTGTTA21
    * | | | | | | | | | | | | | : * | | | : |
    Sbjct:316ACCGAGACTATGGTTTACAGT296
    CGGCTCTGATACCAGTTGTTA
    psRobot
    probable folate-biopterin transporter 2
    5
    phe-miR7783-3p
    3.0
    PH01000002:2868409-2868430|miR7783-3p|PH01000002:2868114-2869609
    PH01000002G4300
    +
    IntronR
    Query:1GTGGCTCTGATACCATGTGGAA22
    * | | | | | | | | | | | | | | * : | | * * |
    Sbjct:317AACCGAGACTATGGTTTACAGT296
    GTGGCTCTGATACCATGTGGAA
    psRobot
    probable folate-biopterin transporter 2
    6
    phe-miR845c
    3.0
    PH01000002:2868406-2868429|miR845c|PH01000002:2868114-2869609
    PH01000002G4300
    +
    IntronR
    Query:1AGGCTCTGATACCAATTGACGGGG24
    * | | | | | | | | | | | | | | * | | * | : * | :
    Sbjct:316ACCGAGACTATGGTTTACAGTGCT293
    AGGCTCTGATACCAATTGACGGGG
    psRobot
    probable folate-biopterin transporter 2
    7
    phe-miR408-3p
    2.8
    PH01000003:28692-28712|miR408-3p|PH01000003:28235-29111
    PH01000003G0060
    -
    IntronR
    Query:1ATGCACTGCCTCTTCCCTGGC21
    | | | | | | : * | | | * | | | | | | : | |
    Sbjct:478TACGTGGAGGAAAAGGGATCG458
    ATGCACTGCCTCTTCCCTGGC
    psRobot
    glyceraldehyde-3-phosphate dehydrogenase
    8
    phe-miR408d
    3.0
    PH01000003:28692-28712|miR408d|PH01000003:28235-29111
    PH01000003G0060
    -
    IntronR
    Query:1GTGCACTGCCTCTTCCCTGGC21
    : | | | | | : * | | | * | | | | | | : | |
    Sbjct:478TACGTGGAGGAAAAGGGATCG458
    GTGCACTGCCTCTTCCCTGGC
    psRobot
    glyceraldehyde-3-phosphate dehydrogenase
    9
    phe-miR6189
    3.0
    PH01000003:1354859-1354880|miR6189|PH01000003:1354346-1355138
    PH01000003G2040
    +
    IntronR
    Query:1AGGGTGATGCTGTGGTGATC-T21
    | | | : | | | | | | : : | | : | | * | | * |
    Sbjct:535TCCTACTACGGTACTACGAGTA514
    AGGGTGATGCTGTGGTGATC-T
    psRobot
    Squamous cell carcinoma antigen recognized by T-cells 3
    10
    phe-miR156j
    2.5
    PH01000004:1936710-1936728|miR156j|PH01000004:1936701-1937570
    PH01000004G3030
    +
    IntronR
    Query:1TGACAGAAGAGGGTGAGCAT20
    | | | | | : | | : | | | : | | | * | | |
    Sbjct:28ACTGTTTTTTCCTACT-GTA10
    TGACAGAAGAGGGTGAGCAT
    psRobot
    RNA polymerase II C-terminal domain phosphatase-like 2
    11
    phe-miR172k
    3.0
    PH01000004:1936887-1936907|miR172k|PH01000004:1936701-1937570
    PH01000004G3030
    +
    IntronR
    Query:1ATCTTGATGATGCTGCATCAG21
    | | * | | | | | | * | | | | | | | | * | *
    Sbjct:207TACAACTACGACGACGTAATG187
    ATCTTGATGATGCTGCATCAG
    psRobot
    RNA polymerase II C-terminal domain phosphatase-like 2
    12
    phe-miR2673a
    3.0
    PH01000005:287868-287886|miR2673a|PH01000005:287437-287918
    PH01000005G0450
    -
    IntronR
    Query:1GGAAGAGGAAGAGGAAGAG19
    : : | | | | | : | | : | | | | | : * :
    Sbjct:450TTTTCTCTTTTTCCTTTGT432
    GGAAGAGGAAGAGGAAGAG
    psRobot
    T-complex 1 subunit theta-like
    13
    phe-miR396g
    3.0
    PH01000005:768069-768087|miR396g|PH01000005:767959-768204
    PH01000005G1200
    -
    IntronR
    Query:1TCCACAGGCTTTCTTGAACG20
    * | | | | | : | | | | | | * | | | * * |
    Sbjct:129TGGTGTTCGAAAGTACT-CC111
    TCCACAGGCTTTCTTGAACG
    psRobot
    U-box domain-containing 33
    14
    phe-miR2673a
    2.8
    PH01000005:1430577-1430595|miR2673a|PH01000005:1429497-1430617
    PH01000005G2310
    +
    AltA
    Query:1GGAAGAGGAAGAGGAAGAG19
    * : | | : | | | | | : | | | | | : | :
    Sbjct:1099GTTTTTCCTTTTCCTTTTT1081
    GGAAGAGGAAGAGGAAGAG
    psRobot
    RNA polymerase sigma factor sigC
    15
    phe-miR2673a
    2.8
    PH01000005:1430577-1430595|miR2673a|PH01000005:1429713-1431181
    PH01000005G2310
    +
    AltD
    Query:1GGAAGAGGAAGAGGAAGAG19
    * : | | : | | | | | : | | | | | : | :
    Sbjct:883GTTTTTCCTTTTCCTTTTT865
    GGAAGAGGAAGAGGAAGAG
    psRobot
    RNA polymerase sigma factor sigC
    16
    phe-miR156f
    3.0
    PH01000005:2511917-2511936|miR156f|PH01000005:2511871-2512670
    PH01000005G3860
    -
    IntronR
    Query:1ATGACAGAAGAGAGAGAGCAC21
    | : : | | | : | | | | : | | | | | | * | *
    Sbjct:66TGTTGTTTTCTTTCTCTC-TA47
    ATGACAGAAGAGAGAGAGCAC
    psRobot
    [Hordeum vulgare vulgare]
    17
    phe-miR2673a
    2.8
    PH01000007:1988639-1988657|miR2673a|PH01000007:1988547-1989170
    PH01000007G2970
    +
    IntronR
    Query:1GGAAGAGGAAGAGGAAGAG19
    | | | * | | | | | | : * | | | | | | :
    Sbjct:111CCTCCTCCTTTCCCTTCTT93
    GGAAGAGGAAGAGGAAGAG
    psRobot
    kinesin light chain 3 [Brachypodium distachyon]
    18
    phe-miR9670-3p
    3.0
    PH01000008:2237326-2237345|miR9670-3p|PH01000008:2237319-2237708
    PH01000008G3210
    +
    IntronR
    Query:1AGGTGGAATACTTGAAGAAGA21
    | | : : | : | | | | | | * | | | | | | * |
    Sbjct:27TCTGCTTTATGATCTTCTT-T8
    AGGTGGAATACTTGAAGAAGA
    psRobot
    THO complex subunit 4D-like
    19
    phe-miR6476a
    3.0
    PH01000011:1983058-1983079|miR6476a|PH01000011:1983039-1983112
    PH01000011G2990
    +
    IntronR
    Query:1TCAGTGGAGATGAAACATTA-A21
    * | | : | | | | | | | : | | | * | | | | * |
    Sbjct:41TGTTACCTCTATTTTTTAATAT20
    TCAGTGGAGATGAAACATTA-A
    psRobot
    autophagy-related 18h-like
    20
    phe-miR845a-3p
    2.8
    PH01000012:283592-283612|miR845a-3p|PH01000012:283069-284188
    PH01000012G0400
    -
    IntronR
    Query:1CGGCTCTGATACCAGTTGTTA21
    * | | | | | | : | | | * | | | | | : : : |
    Sbjct:544ACCGAGATTATAGTCAATGGT524
    CGGCTCTGATACCAGTTGTTA
    psRobot
    glutamyl tRNA reductase
    21
    phe-miR9780
    3.0
    PH01000018:94810-94829|miR9780|PH01000018:94468-95297
    PH01000018G0160
    -
    IntronR
    Query:1TCGGGTCGGCGCTGCACG-C19
    | | | | | * | | | | | | : | | * | | * |
    Sbjct:362AGCCCCGCCGCGGCGCGCTG343
    TCGGGTCGGCGCTGCACG-C
    psRobot
    probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 7-like
    22
    phe-miR396
    1.8
    PH01000018:95215-95232|miR396|PH01000018:94468-95297
    PH01000018G0160
    -
    IntronR
    Query:1TTCCACGGCTTTCTTGAA18
    : | | | | | | : | : | | | | : | | |
    Sbjct:765GAGGTGCTGGAAGAGCTT748
    TTCCACGGCTTTCTTGAA
    psRobot
    probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 7-like
    23
    phe-miR171l-5p
    2.0
    PH01000018:767494-767513|miR171l-5p|PH01000018:767258-768195
    PH01000018G1270
    -
    IntronR
    Query:1TGAGCCGGACCAATATCACT20
    * | | | | | : | | | | | | | | * | | | |
    Sbjct:256TCTCGGTCTGGTTATTGTGA237
    TGAGCCGGACCAATATCACT
    psRobot
    Os01g0755100 [Oryza sativa Japonica Group]
    24
    phe-miR5055
    2.8
    PH01000019:1677213-1677232|miR5055|PH01000019:1677170-1677269
    PH01000019G2280
    +
    IntronR
    Query:1GCCGAGCTCAGCAGCGAGCT20
    : | * | | | | | * | : | | | | | | | | |
    Sbjct:63TGACTCGACTTGTCGCTCGA44
    GCCGAGCTCAGCAGCGAGCT
    psRobot
    Os02g0119300 [Oryza sativa Japonica Group]
    25
    phe-miR2673a
    3.0
    PH01000021:826527-826545|miR2673a|PH01000021:826520-826588
    PH01000021G1380
    -
    IntronR
    Query:1GGAAGAGGAAGAGGAAGAG19
    | | | | | | | : * | | | | : * | | | |
    Sbjct:26CCTTCTCTCTCTCTCTCTC8
    GGAAGAGGAAGAGGAAGAG
    psRobot
    ---NA---
    26
    phe-miR2673a
    3.0
    PH01000024:666540-666557|miR2673a|PH01000024:666528-666862
    PH01000024G0980
    +
    IntronR
    Query:1GGAAGAGGAAGAGGAAGAG19
    | : | | * | : | | | | | : | | | | * |
    Sbjct:30CTTTGTTCTTCTTCTTC-C13
    GGAAGAGGAAGAGGAAGAG
    psRobot
    dynamin-related 5A
    27
    phe-miR529-3p
    2.2
    PH01000026:932774-932794|miR529-3p|PH01000026:931951-932937
    PH01000026G1290
    +
    IntronR
    Query:1GCTGTACCCTCTCTCTTCTTC21
    : | | | | | | | * | | | | | | | | * | | *
    Sbjct:844TGACATGGTAGAGAGAAAAAA824
    GCTGTACCCTCTCTCTTCTTC
    psRobot
    COBW domain-containing 1-like
    28
    phe-miR169a-3p
    2.8
    PH01000026:1312320-1312336|miR169a-3p|PH01000026:1312316-1312390
    PH01000026G1780
    +
    ExonS
    Query:1GGCAAGTTGTTCTTGGCT18
    : | | | | | | | | | : | | | | * * |
    Sbjct:21TCGTTCAACAGGAACA-A5
    GGCAAGTTGTTCTTGGCT
    psRobot
    zinc finger CCCH domain-containing 40-like
    29
    phe-miR5823
    3.0
    PH01000028:791618-791638|miR5823|PH01000028:791384-791816
    PH01000028G1180
    -
    IntronR
    Query:1AAGGAATTGGGTCTAATCCCT21
    | | : | | | : | | | | * | * | | | | | | |
    Sbjct:255TTTCTTGACCCCGCTTAGGGA235
    AAGGAATTGGGTCTAATCCCT
    psRobot
    tRNA-dihydrouridine(20) synthase [NAD(P)+]-like [Brachypodium distachyon]
    30
    phe-miR7539
    3.0
    PH01000030:1674999-1675019|miR7539|PH01000030:1674142-1675080
    PH01000030G2390
    -
    IntronR
    Query:1GAGAGAGAGAGCGACGAGGGG21
    | | | | | | | | | | | * | | * : | : | | :
    Sbjct:878CTCTCTCTCTCTCTCTTTCCT858
    GAGAGAGAGAGCGACGAGGGG
    psRobot
    SCAI homolog