Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Bamboo

Total 5331 records in 178 Pages. Current page: 1
1/178 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
phe-miR2673a
2.0
PH01000000:3920111-3920128|miR2673a|PH01000000:3920006-3920227
PH01000000G6020
-
IntronR
Query:1GGAAGAGGAAGAGGAAGAG19
* | * | | | | | | | | | | | | | | * |
Sbjct:123ACATCTCCTTCTCCTTC-C106
GGAAGAGGAAGAGGAAGAG
psRobot
aquaporin [Oryza sativa Japonica Group]
2
phe-miR1850.1
2.8
PH01000001:91810-91830|miR1850.1|PH01000001:91237-91925
PH01000001G0140
-
IntronR
Query:1TGGAAAGTTGGGAGATTGGGG21
* | : | | | | | | | | : | | | : | : | * |
Sbjct:594TCTTTTCAACCTTCTGATCAC574
TGGAAAGTTGGGAGATTGGGG
psRobot
uncharacterized membrane At1g16860-like
3
phe-miR1850.1
2.8
PH01000001:91770-91790|miR1850.1|PH01000001:91197-91925
PH01000001G0140
-
IntronR
Query:1TGGAAAGTTGGGAGATTGGGG21
* | : | | | | | | | | : | | | : | : | * |
Sbjct:594TCTTTTCAACCTTCTGATCAC574
TGGAAAGTTGGGAGATTGGGG
psRobot
uncharacterized membrane At1g16860-like
4
phe-miR845a-3p
2.2
PH01000002:2868409-2868429|miR845a-3p|PH01000002:2868114-2869609
PH01000002G4300
+
IntronR
Query:1CGGCTCTGATACCAGTTGTTA21
* | | | | | | | | | | | | | : * | | | : |
Sbjct:316ACCGAGACTATGGTTTACAGT296
CGGCTCTGATACCAGTTGTTA
psRobot
probable folate-biopterin transporter 2
5
phe-miR7783-3p
3.0
PH01000002:2868409-2868430|miR7783-3p|PH01000002:2868114-2869609
PH01000002G4300
+
IntronR
Query:1GTGGCTCTGATACCATGTGGAA22
* | | | | | | | | | | | | | | * : | | * * |
Sbjct:317AACCGAGACTATGGTTTACAGT296
GTGGCTCTGATACCATGTGGAA
psRobot
probable folate-biopterin transporter 2
6
phe-miR845c
3.0
PH01000002:2868406-2868429|miR845c|PH01000002:2868114-2869609
PH01000002G4300
+
IntronR
Query:1AGGCTCTGATACCAATTGACGGGG24
* | | | | | | | | | | | | | | * | | * | : * | :
Sbjct:316ACCGAGACTATGGTTTACAGTGCT293
AGGCTCTGATACCAATTGACGGGG
psRobot
probable folate-biopterin transporter 2
7
phe-miR408-3p
2.8
PH01000003:28692-28712|miR408-3p|PH01000003:28235-29111
PH01000003G0060
-
IntronR
Query:1ATGCACTGCCTCTTCCCTGGC21
| | | | | | : * | | | * | | | | | | : | |
Sbjct:478TACGTGGAGGAAAAGGGATCG458
ATGCACTGCCTCTTCCCTGGC
psRobot
glyceraldehyde-3-phosphate dehydrogenase
8
phe-miR408d
3.0
PH01000003:28692-28712|miR408d|PH01000003:28235-29111
PH01000003G0060
-
IntronR
Query:1GTGCACTGCCTCTTCCCTGGC21
: | | | | | : * | | | * | | | | | | : | |
Sbjct:478TACGTGGAGGAAAAGGGATCG458
GTGCACTGCCTCTTCCCTGGC
psRobot
glyceraldehyde-3-phosphate dehydrogenase
9
phe-miR6189
3.0
PH01000003:1354859-1354880|miR6189|PH01000003:1354346-1355138
PH01000003G2040
+
IntronR
Query:1AGGGTGATGCTGTGGTGATC-T21
| | | : | | | | | | : : | | : | | * | | * |
Sbjct:535TCCTACTACGGTACTACGAGTA514
AGGGTGATGCTGTGGTGATC-T
psRobot
Squamous cell carcinoma antigen recognized by T-cells 3
10
phe-miR156j
2.5
PH01000004:1936710-1936728|miR156j|PH01000004:1936701-1937570
PH01000004G3030
+
IntronR
Query:1TGACAGAAGAGGGTGAGCAT20
| | | | | : | | : | | | : | | | * | | |
Sbjct:28ACTGTTTTTTCCTACT-GTA10
TGACAGAAGAGGGTGAGCAT
psRobot
RNA polymerase II C-terminal domain phosphatase-like 2
11
phe-miR172k
3.0
PH01000004:1936887-1936907|miR172k|PH01000004:1936701-1937570
PH01000004G3030
+
IntronR
Query:1ATCTTGATGATGCTGCATCAG21
| | * | | | | | | * | | | | | | | | * | *
Sbjct:207TACAACTACGACGACGTAATG187
ATCTTGATGATGCTGCATCAG
psRobot
RNA polymerase II C-terminal domain phosphatase-like 2
12
phe-miR2673a
3.0
PH01000005:287868-287886|miR2673a|PH01000005:287437-287918
PH01000005G0450
-
IntronR
Query:1GGAAGAGGAAGAGGAAGAG19
: : | | | | | : | | : | | | | | : * :
Sbjct:450TTTTCTCTTTTTCCTTTGT432
GGAAGAGGAAGAGGAAGAG
psRobot
T-complex 1 subunit theta-like
13
phe-miR396g
3.0
PH01000005:768069-768087|miR396g|PH01000005:767959-768204
PH01000005G1200
-
IntronR
Query:1TCCACAGGCTTTCTTGAACG20
* | | | | | : | | | | | | * | | | * * |
Sbjct:129TGGTGTTCGAAAGTACT-CC111
TCCACAGGCTTTCTTGAACG
psRobot
U-box domain-containing 33
14
phe-miR2673a
2.8
PH01000005:1430577-1430595|miR2673a|PH01000005:1429497-1430617
PH01000005G2310
+
AltA
Query:1GGAAGAGGAAGAGGAAGAG19
* : | | : | | | | | : | | | | | : | :
Sbjct:1099GTTTTTCCTTTTCCTTTTT1081
GGAAGAGGAAGAGGAAGAG
psRobot
RNA polymerase sigma factor sigC
15
phe-miR2673a
2.8
PH01000005:1430577-1430595|miR2673a|PH01000005:1429713-1431181
PH01000005G2310
+
AltD
Query:1GGAAGAGGAAGAGGAAGAG19
* : | | : | | | | | : | | | | | : | :
Sbjct:883GTTTTTCCTTTTCCTTTTT865
GGAAGAGGAAGAGGAAGAG
psRobot
RNA polymerase sigma factor sigC
16
phe-miR156f
3.0
PH01000005:2511917-2511936|miR156f|PH01000005:2511871-2512670
PH01000005G3860
-
IntronR
Query:1ATGACAGAAGAGAGAGAGCAC21
| : : | | | : | | | | : | | | | | | * | *
Sbjct:66TGTTGTTTTCTTTCTCTC-TA47
ATGACAGAAGAGAGAGAGCAC
psRobot
[Hordeum vulgare vulgare]
17
phe-miR2673a
2.8
PH01000007:1988639-1988657|miR2673a|PH01000007:1988547-1989170
PH01000007G2970
+
IntronR
Query:1GGAAGAGGAAGAGGAAGAG19
| | | * | | | | | | : * | | | | | | :
Sbjct:111CCTCCTCCTTTCCCTTCTT93
GGAAGAGGAAGAGGAAGAG
psRobot
kinesin light chain 3 [Brachypodium distachyon]
18
phe-miR9670-3p
3.0
PH01000008:2237326-2237345|miR9670-3p|PH01000008:2237319-2237708
PH01000008G3210
+
IntronR
Query:1AGGTGGAATACTTGAAGAAGA21
| | : : | : | | | | | | * | | | | | | * |
Sbjct:27TCTGCTTTATGATCTTCTT-T8
AGGTGGAATACTTGAAGAAGA
psRobot
THO complex subunit 4D-like
19
phe-miR6476a
3.0
PH01000011:1983058-1983079|miR6476a|PH01000011:1983039-1983112
PH01000011G2990
+
IntronR
Query:1TCAGTGGAGATGAAACATTA-A21
* | | : | | | | | | | : | | | * | | | | * |
Sbjct:41TGTTACCTCTATTTTTTAATAT20
TCAGTGGAGATGAAACATTA-A
psRobot
autophagy-related 18h-like
20
phe-miR845a-3p
2.8
PH01000012:283592-283612|miR845a-3p|PH01000012:283069-284188
PH01000012G0400
-
IntronR
Query:1CGGCTCTGATACCAGTTGTTA21
* | | | | | | : | | | * | | | | | : : : |
Sbjct:544ACCGAGATTATAGTCAATGGT524
CGGCTCTGATACCAGTTGTTA
psRobot
glutamyl tRNA reductase
21
phe-miR9780
3.0
PH01000018:94810-94829|miR9780|PH01000018:94468-95297
PH01000018G0160
-
IntronR
Query:1TCGGGTCGGCGCTGCACG-C19
| | | | | * | | | | | | : | | * | | * |
Sbjct:362AGCCCCGCCGCGGCGCGCTG343
TCGGGTCGGCGCTGCACG-C
psRobot
probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 7-like
22
phe-miR396
1.8
PH01000018:95215-95232|miR396|PH01000018:94468-95297
PH01000018G0160
-
IntronR
Query:1TTCCACGGCTTTCTTGAA18
: | | | | | | : | : | | | | : | | |
Sbjct:765GAGGTGCTGGAAGAGCTT748
TTCCACGGCTTTCTTGAA
psRobot
probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 7-like
23
phe-miR171l-5p
2.0
PH01000018:767494-767513|miR171l-5p|PH01000018:767258-768195
PH01000018G1270
-
IntronR
Query:1TGAGCCGGACCAATATCACT20
* | | | | | : | | | | | | | | * | | | |
Sbjct:256TCTCGGTCTGGTTATTGTGA237
TGAGCCGGACCAATATCACT
psRobot
Os01g0755100 [Oryza sativa Japonica Group]
24
phe-miR5055
2.8
PH01000019:1677213-1677232|miR5055|PH01000019:1677170-1677269
PH01000019G2280
+
IntronR
Query:1GCCGAGCTCAGCAGCGAGCT20
: | * | | | | | * | : | | | | | | | | |
Sbjct:63TGACTCGACTTGTCGCTCGA44
GCCGAGCTCAGCAGCGAGCT
psRobot
Os02g0119300 [Oryza sativa Japonica Group]
25
phe-miR2673a
3.0
PH01000021:826527-826545|miR2673a|PH01000021:826520-826588
PH01000021G1380
-
IntronR
Query:1GGAAGAGGAAGAGGAAGAG19
| | | | | | | : * | | | | : * | | | |
Sbjct:26CCTTCTCTCTCTCTCTCTC8
GGAAGAGGAAGAGGAAGAG
psRobot
---NA---
26
phe-miR2673a
3.0
PH01000024:666540-666557|miR2673a|PH01000024:666528-666862
PH01000024G0980
+
IntronR
Query:1GGAAGAGGAAGAGGAAGAG19
| : | | * | : | | | | | : | | | | * |
Sbjct:30CTTTGTTCTTCTTCTTC-C13
GGAAGAGGAAGAGGAAGAG
psRobot
dynamin-related 5A
27
phe-miR529-3p
2.2
PH01000026:932774-932794|miR529-3p|PH01000026:931951-932937
PH01000026G1290
+
IntronR
Query:1GCTGTACCCTCTCTCTTCTTC21
: | | | | | | | * | | | | | | | | * | | *
Sbjct:844TGACATGGTAGAGAGAAAAAA824
GCTGTACCCTCTCTCTTCTTC
psRobot
COBW domain-containing 1-like
28
phe-miR169a-3p
2.8
PH01000026:1312320-1312336|miR169a-3p|PH01000026:1312316-1312390
PH01000026G1780
+
ExonS
Query:1GGCAAGTTGTTCTTGGCT18
: | | | | | | | | | : | | | | * * |
Sbjct:21TCGTTCAACAGGAACA-A5
GGCAAGTTGTTCTTGGCT
psRobot
zinc finger CCCH domain-containing 40-like
29
phe-miR5823
3.0
PH01000028:791618-791638|miR5823|PH01000028:791384-791816
PH01000028G1180
-
IntronR
Query:1AAGGAATTGGGTCTAATCCCT21
| | : | | | : | | | | * | * | | | | | | |
Sbjct:255TTTCTTGACCCCGCTTAGGGA235
AAGGAATTGGGTCTAATCCCT
psRobot
tRNA-dihydrouridine(20) synthase [NAD(P)+]-like [Brachypodium distachyon]
30
phe-miR7539
3.0
PH01000030:1674999-1675019|miR7539|PH01000030:1674142-1675080
PH01000030G2390
-
IntronR
Query:1GAGAGAGAGAGCGACGAGGGG21
| | | | | | | | | | | * | | * : | : | | :
Sbjct:878CTCTCTCTCTCTCTCTTTCCT858
GAGAGAGAGAGCGACGAGGGG
psRobot
SCAI homolog
IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/178 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>