Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Pinus taeda

Total 442 records in 15 Pages. Current page: 1
1/15 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    pta-miR1312
    5
    C32357354:23831-23852|miR1312|C32357354:23578-2734
    PITA_000077472
    +
    AltD
    CTGTGTGCATTTTCTCTCAAAA

    TTTGGAGAGAAAATGGCGACAT
    miRferno
    -tyrosine-phosphatase MKP1-like [Pyrus x bretschneideri]
    2
    pta-miR319
    5.5
    C32357354:25711-25729|miR319|C32357354:23578-27348
    PITA_000077472
    +
    AltD
    GCAGCTCCAATGAGTCCTA

    TTGGACTGAAGGGAGCTCC
    miRferno
    -tyrosine-phosphatase MKP1-like [Pyrus x bretschneideri]
    3
    pta-miR1316
    5
    scaffold425699:123660-123680|miR1316|scaffold42569
    PITA_000038571
    -
    ExonS
    TTGCAATGGTTTCTGTTGTGA

    TCCATACACAAACCATTGGAA
    miRferno
    Os03g0165400 [Oryza sativa Japonica Group]
    4
    pta-miR948
    4
    scaffold452186:11432-11451|miR948|scaffold452186:1
    PITA_000092056
    -
    IntronR
    CCGAATCCGACAAAGCCTGC

    TCAGGCTGTGTGGGATCCGG
    miRferno
    receptor kinase At4g00960
    5
    pta-miR156b
    3.0
    scaffold808001.2:8610-8628|miR156b|scaffold808001.
    PITA_000086935
    +
    IntronR
    Query:1CAGAAGATAGAGAGCACAAC20
    | | | | | : | | * | | : | : | | | * | |
    Sbjct:3561GTCTTTTACCTTTTGTG-TG3543
    CAGAAGATAGAGAGCACAAC
    psRobot
    stachyose synthase
    6
    pta-miR156b
    3.0
    scaffold808001.2:8610-8628|miR156b|scaffold808001.
    PITA_000086935
    +
    AltA
    Query:1CAGAAGATAGAGAGCACAAC20
    | | | | | : | | * | | : | : | | | * | |
    Sbjct:2627GTCTTTTACCTTTTGTG-TG2609
    CAGAAGATAGAGAGCACAAC
    psRobot
    stachyose synthase
    7
    pta-miR156a
    3.0
    scaffold808001.2:8610-8628|miR156a|scaffold808001.
    PITA_000086935
    +
    IntronR
    Query:1CAGAAGATAGAGAGCACATC20
    | | | | | : | | * | | : | : | | | | * |
    Sbjct:3561GTCTTTTACCTTTTGTGT-G3543
    CAGAAGATAGAGAGCACATC
    psRobot
    stachyose synthase
    8
    pta-miR156a
    3.0
    scaffold808001.2:8610-8628|miR156a|scaffold808001.
    PITA_000086935
    +
    AltA
    Query:1CAGAAGATAGAGAGCACATC20
    | | | | | : | | * | | : | : | | | | * |
    Sbjct:2627GTCTTTTACCTTTTGTGT-G2609
    CAGAAGATAGAGAGCACATC
    psRobot
    stachyose synthase
    9
    pta-miR156b
    4.5
    tscaffold1281:109937-109956|miR156b|tscaffold1281:
    PITA_000040617
    -
    IntronR
    GTTTTAATCTCTGTATTCTG

    CAGAAGATAGAGAGCACAAC
    miRferno
    hypothetical protein AMTR_s00070p00103330
    10
    pta-miR1316
    5
    tscaffold1450:52030-52050|miR1316|tscaffold1450:49
    PITA_000008441
    +
    IntronR
    TTCCAATCGTTCATGCTTGGA

    TCCATACACAAACCATTGGAA
    miRferno
    phopholipase d [Ricinus communis]
    11
    pta-miR156b
    4.5
    C32565904:119615-119634|miR156b|C32565904:119548-1
    PITA_000031734
    +
    IntronR
    CTTGTGCAATCTGTCTTGTG

    CAGAAGATAGAGAGCACAAC
    miRferno
    seed maturation PM36
    12
    pta-miR156b
    4.5
    C32565904:119615-119634|miR156b|C32565904:119552-1
    PITA_000031734
    +
    IntronR
    CTTGTGCAATCTGTCTTGTG

    CAGAAGATAGAGAGCACAAC
    miRferno
    seed maturation PM36
    13
    pta-miR319
    5.5
    C32571688:109834-109852|miR319|C32571688:109680-11
    PITA_000018697
    -
    AltD
    GGCGTCACCTTAAGTCCAA

    TTGGACTGAAGGGAGCTCC
    miRferno
    Pollen Ole e 1 allergen and extensin family [Theobroma cacao]
    14
    pta-miR952a
    2.8
    C32533302:16093-16112|miR952a|C32533302:16083-1614
    PITA_000053563
    -
    ExonS
    Query:1AACAGAGCATGCCGTTGGTT20
    * | * | | | | | | | | | | | * | | : | |
    Sbjct:30GTCTCTCGTACGGCCACTAA11
    AACAGAGCATGCCGTTGGTT
    psRobot
    O-acyltransferase WSD1-like isoform X1
    15
    pta-miR952a
    2.8
    C32533302:16097-16116|miR952a|C32533302:16083-1614
    PITA_000053563
    -
    ExonS
    Query:1AACAGAGCATGCCGTTGGTT20
    * | * | | | | | | | | | | | * | | : | |
    Sbjct:34GTCTCTCGTACGGCCACTAA15
    AACAGAGCATGCCGTTGGTT
    psRobot
    O-acyltransferase WSD1-like isoform X1
    16
    pta-miR952a
    2.8
    C32533302:16127-16146|miR952a|C32533302:16113-1614
    PITA_000053563
    -
    AltA
    Query:1AACAGAGCATGCCGTTGGTT20
    * | * | | | | | | | | | | | * | | : | |
    Sbjct:34GTCTCTCGTACGGCCACTAA15
    AACAGAGCATGCCGTTGGTT
    psRobot
    O-acyltransferase WSD1-like isoform X1
    17
    pta-miR952a
    3.5
    C32533302:16116-16135|miR952a|C32533302:16113-1614
    PITA_000053563
    -
    AltA
    AATCACCGGCATGCTCTCTG

    AACAGAGCATGCCGTTGGTT
    miRferno
    O-acyltransferase WSD1-like isoform X1
    18
    pta-miR952a
    3.5
    C32533302:16116-16135|miR952a|C32533302:16083-1614
    PITA_000053563
    -
    ExonS
    AATCACCGGCATGCTCTCTG

    AACAGAGCATGCCGTTGGTT
    miRferno
    O-acyltransferase WSD1-like isoform X1
    19
    pta-miR952a
    3.5
    C32533302:16116-16135|miR952a|C32533302:16083-1614
    PITA_000053563
    -
    ExonS
    AATCACCGGCATGCTCTCTG

    AACAGAGCATGCCGTTGGTT
    miRferno
    O-acyltransferase WSD1-like isoform X1
    20
    pta-miR946a-3p;pta-miR946b
    5
    scaffold117691.1:117999-118019|miR946a-3p;pta-miR9
    PITA_000041396
    +
    IntronR
    TTGTGGAGAGGAAACGGGCAA

    CAGCCCTTCTCCTATCCACAA
    miRferno
    transmembrane 53-like [Nelumbo nucifera]
    21
    pta-miR952a
    4.5
    scaffold149302.3:67048-67067|miR952a|scaffold14930
    PITA_000037825
    +
    IntronR
    AACCAAGGGCATGGTTTTTG

    AACAGAGCATGCCGTTGGTT
    miRferno
    [Physcomitrella patens]
    22
    pta-miR952a
    4.5
    scaffold149302.3:67048-67067|miR952a|scaffold14930
    PITA_000037825
    +
    IntronR
    AACCAAGGGCATGGTTTTTG

    AACAGAGCATGCCGTTGGTT
    miRferno
    [Physcomitrella patens]
    23
    pta-miR156b
    3.0
    scaffold135452.2:41119-41138|miR156b|scaffold13545
    PITA_000033253
    +
    IntronR
    Query:1CAGAAGATAGAGAGCACAAC20
    | | | | | | | | | | | | | * | * | * * |
    Sbjct:136GTCTTCTATCTCTAGGGGAG117
    CAGAAGATAGAGAGCACAAC
    psRobot
    transmembrane 45B [Amborella trichopoda]
    24
    pta-miR156a
    2.5
    scaffold135452.2:41119-41138|miR156a|scaffold13545
    PITA_000033253
    +
    IntronR
    Query:1CAGAAGATAGAGAGCACATC20
    | | | | | | | | | | | | | * | * | * | |
    Sbjct:136GTCTTCTATCTCTAGGGGAG117
    CAGAAGATAGAGAGCACATC
    psRobot
    transmembrane 45B [Amborella trichopoda]
    25
    pta-miR156b
    4
    scaffold135452.2:41119-41138|miR156b|scaffold13545
    PITA_000033253
    +
    IntronR
    GAGGGGATCTCTATCTTCTG

    CAGAAGATAGAGAGCACAAC
    miRferno
    transmembrane 45B [Amborella trichopoda]
    26
    pta-miR156a
    3
    scaffold135452.2:41119-41138|miR156a|scaffold13545
    PITA_000033253
    +
    IntronR
    GAGGGGATCTCTATCTTCTG

    CAGAAGATAGAGAGCACATC
    miRferno
    transmembrane 45B [Amborella trichopoda]
    27
    pta-miR1316
    4.5
    scaffold171954:131874-131894|miR1316|scaffold17195
    PITA_000021050
    -
    IntronR
    TTCCAGTTTTTTGTGTATCAA

    TCCATACACAAACCATTGGAA
    miRferno
    geranylgeranyl transferase type-2 subunit beta-like [Nelumbo nucifera]
    28
    pta-miR1312
    5.5
    scaffold178230:21599-21620|miR1312|scaffold178230:
    PITA_000082344
    +
    AltA
    ATGATGCCTTTCTCTATCCAAA

    TTTGGAGAGAAAATGGCGACAT
    miRferno
    [Physcomitrella patens]
    29
    pta-miR156b
    4.5
    scaffold232369.1:62228-62247|miR156b|scaffold23236
    PITA_000040012
    +
    IntronR
    GTTGTGTTCCCCATCTTGTT

    CAGAAGATAGAGAGCACAAC
    miRferno
    AP2 ERF and B3 domain-containing transcription factor RAV1-like
    30
    pta-miR156b
    4.5
    scaffold232369.1:62228-62247|miR156b|scaffold23236
    PITA_000040012
    +
    IntronR
    GTTGTGTTCCCCATCTTGTT

    CAGAAGATAGAGAGCACAAC
    miRferno
    AP2 ERF and B3 domain-containing transcription factor RAV1-like