Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Pinus taeda

Total 442 records in 15 Pages. Current page: 1
1/15 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
pta-miR1312
5
C32357354:23831-23852|miR1312|C32357354:23578-2734
PITA_000077472
+
AltD
CTGTGTGCATTTTCTCTCAAAA

TTTGGAGAGAAAATGGCGACAT
miRferno
-tyrosine-phosphatase MKP1-like [Pyrus x bretschneideri]
2
pta-miR319
5.5
C32357354:25711-25729|miR319|C32357354:23578-27348
PITA_000077472
+
AltD
GCAGCTCCAATGAGTCCTA

TTGGACTGAAGGGAGCTCC
miRferno
-tyrosine-phosphatase MKP1-like [Pyrus x bretschneideri]
3
pta-miR1316
5
scaffold425699:123660-123680|miR1316|scaffold42569
PITA_000038571
-
ExonS
TTGCAATGGTTTCTGTTGTGA

TCCATACACAAACCATTGGAA
miRferno
Os03g0165400 [Oryza sativa Japonica Group]
4
pta-miR948
4
scaffold452186:11432-11451|miR948|scaffold452186:1
PITA_000092056
-
IntronR
CCGAATCCGACAAAGCCTGC

TCAGGCTGTGTGGGATCCGG
miRferno
receptor kinase At4g00960
5
pta-miR156b
3.0
scaffold808001.2:8610-8628|miR156b|scaffold808001.
PITA_000086935
+
IntronR
Query:1CAGAAGATAGAGAGCACAAC20
| | | | | : | | * | | : | : | | | * | |
Sbjct:3561GTCTTTTACCTTTTGTG-TG3543
CAGAAGATAGAGAGCACAAC
psRobot
stachyose synthase
6
pta-miR156b
3.0
scaffold808001.2:8610-8628|miR156b|scaffold808001.
PITA_000086935
+
AltA
Query:1CAGAAGATAGAGAGCACAAC20
| | | | | : | | * | | : | : | | | * | |
Sbjct:2627GTCTTTTACCTTTTGTG-TG2609
CAGAAGATAGAGAGCACAAC
psRobot
stachyose synthase
7
pta-miR156a
3.0
scaffold808001.2:8610-8628|miR156a|scaffold808001.
PITA_000086935
+
IntronR
Query:1CAGAAGATAGAGAGCACATC20
| | | | | : | | * | | : | : | | | | * |
Sbjct:3561GTCTTTTACCTTTTGTGT-G3543
CAGAAGATAGAGAGCACATC
psRobot
stachyose synthase
8
pta-miR156a
3.0
scaffold808001.2:8610-8628|miR156a|scaffold808001.
PITA_000086935
+
AltA
Query:1CAGAAGATAGAGAGCACATC20
| | | | | : | | * | | : | : | | | | * |
Sbjct:2627GTCTTTTACCTTTTGTGT-G2609
CAGAAGATAGAGAGCACATC
psRobot
stachyose synthase
9
pta-miR156b
4.5
tscaffold1281:109937-109956|miR156b|tscaffold1281:
PITA_000040617
-
IntronR
GTTTTAATCTCTGTATTCTG

CAGAAGATAGAGAGCACAAC
miRferno
hypothetical protein AMTR_s00070p00103330
10
pta-miR1316
5
tscaffold1450:52030-52050|miR1316|tscaffold1450:49
PITA_000008441
+
IntronR
TTCCAATCGTTCATGCTTGGA

TCCATACACAAACCATTGGAA
miRferno
phopholipase d [Ricinus communis]
11
pta-miR156b
4.5
C32565904:119615-119634|miR156b|C32565904:119548-1
PITA_000031734
+
IntronR
CTTGTGCAATCTGTCTTGTG

CAGAAGATAGAGAGCACAAC
miRferno
seed maturation PM36
12
pta-miR156b
4.5
C32565904:119615-119634|miR156b|C32565904:119552-1
PITA_000031734
+
IntronR
CTTGTGCAATCTGTCTTGTG

CAGAAGATAGAGAGCACAAC
miRferno
seed maturation PM36
13
pta-miR319
5.5
C32571688:109834-109852|miR319|C32571688:109680-11
PITA_000018697
-
AltD
GGCGTCACCTTAAGTCCAA

TTGGACTGAAGGGAGCTCC
miRferno
Pollen Ole e 1 allergen and extensin family [Theobroma cacao]
14
pta-miR952a
2.8
C32533302:16093-16112|miR952a|C32533302:16083-1614
PITA_000053563
-
ExonS
Query:1AACAGAGCATGCCGTTGGTT20
* | * | | | | | | | | | | | * | | : | |
Sbjct:30GTCTCTCGTACGGCCACTAA11
AACAGAGCATGCCGTTGGTT
psRobot
O-acyltransferase WSD1-like isoform X1
15
pta-miR952a
2.8
C32533302:16097-16116|miR952a|C32533302:16083-1614
PITA_000053563
-
ExonS
Query:1AACAGAGCATGCCGTTGGTT20
* | * | | | | | | | | | | | * | | : | |
Sbjct:34GTCTCTCGTACGGCCACTAA15
AACAGAGCATGCCGTTGGTT
psRobot
O-acyltransferase WSD1-like isoform X1
16
pta-miR952a
2.8
C32533302:16127-16146|miR952a|C32533302:16113-1614
PITA_000053563
-
AltA
Query:1AACAGAGCATGCCGTTGGTT20
* | * | | | | | | | | | | | * | | : | |
Sbjct:34GTCTCTCGTACGGCCACTAA15
AACAGAGCATGCCGTTGGTT
psRobot
O-acyltransferase WSD1-like isoform X1
17
pta-miR952a
3.5
C32533302:16116-16135|miR952a|C32533302:16113-1614
PITA_000053563
-
AltA
AATCACCGGCATGCTCTCTG

AACAGAGCATGCCGTTGGTT
miRferno
O-acyltransferase WSD1-like isoform X1
18
pta-miR952a
3.5
C32533302:16116-16135|miR952a|C32533302:16083-1614
PITA_000053563
-
ExonS
AATCACCGGCATGCTCTCTG

AACAGAGCATGCCGTTGGTT
miRferno
O-acyltransferase WSD1-like isoform X1
19
pta-miR952a
3.5
C32533302:16116-16135|miR952a|C32533302:16083-1614
PITA_000053563
-
ExonS
AATCACCGGCATGCTCTCTG

AACAGAGCATGCCGTTGGTT
miRferno
O-acyltransferase WSD1-like isoform X1
20
pta-miR946a-3p;pta-miR946b
5
scaffold117691.1:117999-118019|miR946a-3p;pta-miR9
PITA_000041396
+
IntronR
TTGTGGAGAGGAAACGGGCAA

CAGCCCTTCTCCTATCCACAA
miRferno
transmembrane 53-like [Nelumbo nucifera]
21
pta-miR952a
4.5
scaffold149302.3:67048-67067|miR952a|scaffold14930
PITA_000037825
+
IntronR
AACCAAGGGCATGGTTTTTG

AACAGAGCATGCCGTTGGTT
miRferno
[Physcomitrella patens]
22
pta-miR952a
4.5
scaffold149302.3:67048-67067|miR952a|scaffold14930
PITA_000037825
+
IntronR
AACCAAGGGCATGGTTTTTG

AACAGAGCATGCCGTTGGTT
miRferno
[Physcomitrella patens]
23
pta-miR156b
3.0
scaffold135452.2:41119-41138|miR156b|scaffold13545
PITA_000033253
+
IntronR
Query:1CAGAAGATAGAGAGCACAAC20
| | | | | | | | | | | | | * | * | * * |
Sbjct:136GTCTTCTATCTCTAGGGGAG117
CAGAAGATAGAGAGCACAAC
psRobot
transmembrane 45B [Amborella trichopoda]
24
pta-miR156a
2.5
scaffold135452.2:41119-41138|miR156a|scaffold13545
PITA_000033253
+
IntronR
Query:1CAGAAGATAGAGAGCACATC20
| | | | | | | | | | | | | * | * | * | |
Sbjct:136GTCTTCTATCTCTAGGGGAG117
CAGAAGATAGAGAGCACATC
psRobot
transmembrane 45B [Amborella trichopoda]
25
pta-miR156b
4
scaffold135452.2:41119-41138|miR156b|scaffold13545
PITA_000033253
+
IntronR
GAGGGGATCTCTATCTTCTG

CAGAAGATAGAGAGCACAAC
miRferno
transmembrane 45B [Amborella trichopoda]
26
pta-miR156a
3
scaffold135452.2:41119-41138|miR156a|scaffold13545
PITA_000033253
+
IntronR
GAGGGGATCTCTATCTTCTG

CAGAAGATAGAGAGCACATC
miRferno
transmembrane 45B [Amborella trichopoda]
27
pta-miR1316
4.5
scaffold171954:131874-131894|miR1316|scaffold17195
PITA_000021050
-
IntronR
TTCCAGTTTTTTGTGTATCAA

TCCATACACAAACCATTGGAA
miRferno
geranylgeranyl transferase type-2 subunit beta-like [Nelumbo nucifera]
28
pta-miR1312
5.5
scaffold178230:21599-21620|miR1312|scaffold178230:
PITA_000082344
+
AltA
ATGATGCCTTTCTCTATCCAAA

TTTGGAGAGAAAATGGCGACAT
miRferno
[Physcomitrella patens]
29
pta-miR156b
4.5
scaffold232369.1:62228-62247|miR156b|scaffold23236
PITA_000040012
+
IntronR
GTTGTGTTCCCCATCTTGTT

CAGAAGATAGAGAGCACAAC
miRferno
AP2 ERF and B3 domain-containing transcription factor RAV1-like
30
pta-miR156b
4.5
scaffold232369.1:62228-62247|miR156b|scaffold23236
PITA_000040012
+
IntronR
GTTGTGTTCCCCATCTTGTT

CAGAAGATAGAGAGCACAAC
miRferno
AP2 ERF and B3 domain-containing transcription factor RAV1-like
IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/15 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>