Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Populus trichocarpaV3

Total 3084 records in 103 Pages. Current page: 1
1/103 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
ptc-miR172b-5p;ptc-miR172g-5p
2.5
Chr10:3512093-3512112|ptc-miR172b-5p;ptc-miR172g-5p|Chr10:3511683-3512745
Potri.010G024600
+
IntronR
Query:1GGAGCATCATCAAGATTCACA21
* | | : | | | | | : | | | | | | | | * * |
Sbjct:430ACTTGTAGTGGTTCTAAG-AT411
GGAGCATCATCAAGATTCACA
psRobot
CAP-Gly domain-containing linker 1-like isoform X1
2
ptc-miR399i
5
Chr10:18135538-18135558|ptc-miR399i|Chr10:18135405-18135773
Potri.010G184300
+
IntronR
TATGTCAAGCCTCCTTTGACA

TGCCAAAGGAGAGTTGCCCTA
miRferno
cytosolic endo-beta-N-acetylglucosaminidase-like
3
ptc-miR6480
5
Chr10:11289203-11289223|ptc-miR6480|Chr10:11289107-11289354
Potri.010G089200
+
IntronR
TTAATTAAATAGTTTCAGCAC

TTGCTGAAACGATTGAACTAT
miRferno
thermospermine synthase ACAULIS5-like [Populus euphratica]
4
ptc-miR7826
5
Chr10:18193971-18193991|ptc-miR7826|Chr10:18193970-18194429
Potri.010G185000
+
IntronR
TAAGATTTTTAAACTTTGCAA

TTACCAAGTTTCAAATTCTCA
miRferno
S-adenosyl-L-methionine-dependent methyltransferases superfamily isoform 1 [Theobroma cacao]
5
ptc-miR1444b;ptc-miR1444c
5.0
Chr10:17740782-17740801|ptc-miR1444b;ptc-miR1444c|Chr10:17740465-17741418
Potri.010G178200
-
AltA
GAGCTCTGAAGGAATGTGAA

TTCACATTCGGTCAACGTTC
miRferno
acetolactate synthase small subunit chloroplastic-like
6
ptc-miR1444b;ptc-miR1444c
5.0
Chr10:17740782-17740801|ptc-miR1444b;ptc-miR1444c|Chr10:17740465-17741693
Potri.010G178200
-
IntronR
GAGCTCTGAAGGAATGTGAA

TTCACATTCGGTCAACGTTC
miRferno
acetolactate synthase small subunit chloroplastic-like
7
ptc-miR6476a;ptc-miR6476b;ptc-miR6476c
3.0
Chr10:12506167-12506186|ptc-miR6476a;ptc-miR6476b;ptc-miR6476c|Chr10:12505882-12506677
Potri.010G104500
+
IntronR
Query:1TCAGTGGAGATGAAACATGA20
* | | | | | : | : | | | * | | | | : : |
Sbjct:305TGTCACTTTTACGTTGTGTT286
TCAGTGGAGATGAAACATGA
psRobot
alpha,alpha-trehalose-phosphate synthase [UDP-forming] 6
8
ptc-miR482a.2
1.5
Chr10:21293743-21293762|ptc-miR482a.2|Chr10:21293602-21294476
Potri.010G231200
-
AltA
Query:1TCTTGCCTACTCCTCCCATT20
| | | | | | | : | | | | | | * | | | | |
Sbjct:161AGAACGGGTGAGGAAGGTAA142
TCTTGCCTACTCCTCCCATT
psRobot
TMV resistance N-like
9
ptc-miR482a.1
1.5
Chr10:21293741-21293757|ptc-miR482a.1|Chr10:21293602-21294476
Potri.010G231200
-
AltA
Query:1CCTACTCCTCCCATTCC17
| | : | | | | | | * | | | | | | |
Sbjct:156GGGTGAGGAAGGTAAGG140
CCTACTCCTCCCATTCC
psRobot
TMV resistance N-like
10
ptc-miR160b-3p;ptc-miR160c-3p
3.0
Chr10:16974109-16974128|ptc-miR160b-3p;ptc-miR160c-3p|Chr10:16973591-16975061
Potri.010G166500
-
IntronR
Query:1GCGTATGAGGAGCCATGCATA21
| * | | | | | | : | | | | | | | : * * | |
Sbjct:538CACATACTTCTCGGTAT-AAT519
GCGTATGAGGAGCCATGCATA
psRobot
uncharacterized endoplasmic reticulum membrane -like
11
ptc-miR1444b;ptc-miR1444c
4.5
Chr10:20705687-20705706|ptc-miR1444b;ptc-miR1444c|Chr10:20705350-20706316
Potri.010G222800
-
IntronR
CAACATTGAACGAAAGTGAG

TTCACATTCGGTCAACGTTC
miRferno
nudix family [Populus trichocarpa]
12
ptc-miR6451
3.0
Chr10:18552669-18552689|ptc-miR6451|Chr10:18552523-18553281
Potri.010G190100
-
IntronR
Query:1ATGTCAGATCATGTTAGGTAT21
| | | | | | | * | | | | | : | | : * | * |
Sbjct:167TACAGTCCAGTACGATTAAAA147
ATGTCAGATCATGTTAGGTAT
psRobot
arginyl-tRNA-- transferase 1 isoform X1
13
ptc-miR6451
3.0
Chr10:18552722-18552742|ptc-miR6451|Chr10:18552523-18553334
Potri.010G190100
-
IntronR
Query:1ATGTCAGATCATGTTAGGTAT21
| | | | | | | * | | | | | : | | : * | * |
Sbjct:220TACAGTCCAGTACGATTAAAA200
ATGTCAGATCATGTTAGGTAT
psRobot
arginyl-tRNA-- transferase 1 isoform X1
14
ptc-miR530b
4.0
Chr10:18555619-18555638|ptc-miR530b|Chr10:18554894-18556003
Potri.010G190100
-
ExonS
AGGATGCAAGTCGAAGTGCA

TGCATTTGCACCTGCATCTT
miRferno
arginyl-tRNA-- transferase 1 isoform X1
15
ptc-miR6451
5.0
Chr10:18553115-18553135|ptc-miR6451|Chr10:18552523-18553281
Potri.010G190100
-
IntronR
AAAATTAGCATGACCTGACAT

ATGTCAGATCATGTTAGGTAT
miRferno
arginyl-tRNA-- transferase 1 isoform X1
16
ptc-miR6451
5.0
Chr10:18553115-18553135|ptc-miR6451|Chr10:18552523-18553334
Potri.010G190100
-
IntronR
AAAATTAGCATGACCTGACAT

ATGTCAGATCATGTTAGGTAT
miRferno
arginyl-tRNA-- transferase 1 isoform X1
17
ptc-miR472b
4.5
Chr10:6122402-6122423|ptc-miR472b|Chr10:6121845-6122821
Potri.010G035100
-
IntronR
TGGATGGATGGACTTGGGGATA

TTTTCCCAACTCCACCCATCCC
miRferno
Actin cross-linking [Theobroma cacao]
18
ptc-miR6425a-3p;ptc-miR6425b-3p;ptc-miR6425c-3p;pt
3.0
Chr10:21878178-21878198|ptc-miR6425a-3p;ptc-miR6425b-3p;ptc-miR6425c-3p;ptc-miR6425d-3p|Chr10:21877952-21878714
Potri.010G242100
+
IntronR
Query:1TCCATGGAAGATAATGACTCG21
* | | | | | | | | | | | | | : : | * | * *
Sbjct:247CGGTACCTTCTATTGTTCAAA227
TCCATGGAAGATAATGACTCG
psRobot
nudix hydrolase chloroplastic
19
ptc-miR7813
2.5
Chr10:6043573-6043592|ptc-miR7813|Chr10:6043489-6043599
Potri.010G034800
-
ExonS
Query:1TGGTAATGCAAGTGTTGCTAA21
* | | | | | | : | | | : | : | | | | * | |
Sbjct:104TCCATTATGTTTATAACG-TT85
TGGTAATGCAAGTGTTGCTAA
psRobot
AMP deaminase-like
20
ptc-miR7813
2.5
Chr10:6043575-6043594|ptc-miR7813|Chr10:6043489-6043601
Potri.010G034800
-
ExonS
Query:1TGGTAATGCAAGTGTTGCTAA21
* | | | | | | : | | | : | : | | | | * | |
Sbjct:106TCCATTATGTTTATAACG-TT87
TGGTAATGCAAGTGTTGCTAA
psRobot
AMP deaminase-like
21
ptc-miR530b
5
Chr10:15771794-15771813|ptc-miR530b|Chr10:15771373-15772201
Potri.010G148600
-
IntronR
AACATGAAGGTAAATATGCA

TGCATTTGCACCTGCATCTT
miRferno
ER membrane complex subunit 6
22
ptc-miR6459b
4.0
Chr10:19712373-19712392|ptc-miR6459b|Chr10:19712246-19712818
Potri.010G206800
+
AltD
GGTAGGATTTTGGCTTGATA

TCTCAAGCCCAAATTCGATC
miRferno
Ubiquitin-conjugating enzyme E2 7 family [Populus trichocarpa]
23
ptc-miR7825
3.0
Chr10:312745-312766|ptc-miR7825|Chr10:312739-313432
Potri.010G003300
-
AltD
Query:1TTGAAGAAAGGTAGACAGATAG22
| | | | | | | | | | : | | : | * | | | * * |
Sbjct:28AACTTCTTTCTATTTCTCTTAC7
TTGAAGAAAGGTAGACAGATAG
psRobot
SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A 1
24
ptc-miR7825
3.0
Chr10:312675-312696|ptc-miR7825|Chr10:312668-313433
Potri.010G003300
-
IntronR
Query:1TTGAAGAAAGGTAGACAGATAG22
| | | | | | | | | | : | | : | * | | | * * |
Sbjct:29AACTTCTTTCTATTTCTCTTAC8
TTGAAGAAAGGTAGACAGATAG
psRobot
SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A 1
25
ptc-miR7825
3.0
Chr10:312815-312836|ptc-miR7825|Chr10:312808-313433
Potri.010G003300
-
IntronR
Query:1TTGAAGAAAGGTAGACAGATAG22
| | | | | | | | | | : | | : | * | | | * * |
Sbjct:29AACTTCTTTCTATTTCTCTTAC8
TTGAAGAAAGGTAGACAGATAG
psRobot
SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A 1
26
ptc-miR7825
4.0
Chr10:313405-313426|ptc-miR7825|Chr10:312808-313433
Potri.010G003300
-
IntronR
CATTCTCTTTATCTTTCTTCAA

TTGAAGAAAGGTAGACAGATAG
miRferno
SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A 1
27
ptc-miR7825
4.0
Chr10:313405-313426|ptc-miR7825|Chr10:312739-313432
Potri.010G003300
-
AltD
CATTCTCTTTATCTTTCTTCAA

TTGAAGAAAGGTAGACAGATAG
miRferno
SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A 1
28
ptc-miR7825
4.0
Chr10:313405-313426|ptc-miR7825|Chr10:312668-313433
Potri.010G003300
-
IntronR
CATTCTCTTTATCTTTCTTCAA

TTGAAGAAAGGTAGACAGATAG
miRferno
SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A 1
29
ptc-miR168a-3p;ptc-miR168b-3p
4.5
Chr10:10994323-10994343|ptc-miR168a-3p;ptc-miR168b-3p|Chr10:10994113-10994749
Potri.010G084100
-
AltA
TTTTAGCTGATGCAAGAAGGG

CCCGCCTTGCATCAACTGAAT
miRferno
ATP-dependent RNA helicase mitochondrial isoform X2
30
ptc-miR168a-3p;ptc-miR168b-3p
4.5
Chr10:10994323-10994343|ptc-miR168a-3p;ptc-miR168b-3p|Chr10:10994127-10994749
Potri.010G084100
-
AltA
TTTTAGCTGATGCAAGAAGGG

CCCGCCTTGCATCAACTGAAT
miRferno
ATP-dependent RNA helicase mitochondrial isoform X2
IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/103 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>