Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Populus trichocarpaV3

Total 3084 records in 103 Pages. Current page: 1
1/103 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    ptc-miR172b-5p;ptc-miR172g-5p
    2.5
    Chr10:3512093-3512112|ptc-miR172b-5p;ptc-miR172g-5p|Chr10:3511683-3512745
    Potri.010G024600
    +
    IntronR
    Query:1GGAGCATCATCAAGATTCACA21
    * | | : | | | | | : | | | | | | | | * * |
    Sbjct:430ACTTGTAGTGGTTCTAAG-AT411
    GGAGCATCATCAAGATTCACA
    psRobot
    CAP-Gly domain-containing linker 1-like isoform X1
    2
    ptc-miR399i
    5
    Chr10:18135538-18135558|ptc-miR399i|Chr10:18135405-18135773
    Potri.010G184300
    +
    IntronR
    TATGTCAAGCCTCCTTTGACA

    TGCCAAAGGAGAGTTGCCCTA
    miRferno
    cytosolic endo-beta-N-acetylglucosaminidase-like
    3
    ptc-miR6480
    5
    Chr10:11289203-11289223|ptc-miR6480|Chr10:11289107-11289354
    Potri.010G089200
    +
    IntronR
    TTAATTAAATAGTTTCAGCAC

    TTGCTGAAACGATTGAACTAT
    miRferno
    thermospermine synthase ACAULIS5-like [Populus euphratica]
    4
    ptc-miR7826
    5
    Chr10:18193971-18193991|ptc-miR7826|Chr10:18193970-18194429
    Potri.010G185000
    +
    IntronR
    TAAGATTTTTAAACTTTGCAA

    TTACCAAGTTTCAAATTCTCA
    miRferno
    S-adenosyl-L-methionine-dependent methyltransferases superfamily isoform 1 [Theobroma cacao]
    5
    ptc-miR1444b;ptc-miR1444c
    5.0
    Chr10:17740782-17740801|ptc-miR1444b;ptc-miR1444c|Chr10:17740465-17741418
    Potri.010G178200
    -
    AltA
    GAGCTCTGAAGGAATGTGAA

    TTCACATTCGGTCAACGTTC
    miRferno
    acetolactate synthase small subunit chloroplastic-like
    6
    ptc-miR1444b;ptc-miR1444c
    5.0
    Chr10:17740782-17740801|ptc-miR1444b;ptc-miR1444c|Chr10:17740465-17741693
    Potri.010G178200
    -
    IntronR
    GAGCTCTGAAGGAATGTGAA

    TTCACATTCGGTCAACGTTC
    miRferno
    acetolactate synthase small subunit chloroplastic-like
    7
    ptc-miR6476a;ptc-miR6476b;ptc-miR6476c
    3.0
    Chr10:12506167-12506186|ptc-miR6476a;ptc-miR6476b;ptc-miR6476c|Chr10:12505882-12506677
    Potri.010G104500
    +
    IntronR
    Query:1TCAGTGGAGATGAAACATGA20
    * | | | | | : | : | | | * | | | | : : |
    Sbjct:305TGTCACTTTTACGTTGTGTT286
    TCAGTGGAGATGAAACATGA
    psRobot
    alpha,alpha-trehalose-phosphate synthase [UDP-forming] 6
    8
    ptc-miR482a.2
    1.5
    Chr10:21293743-21293762|ptc-miR482a.2|Chr10:21293602-21294476
    Potri.010G231200
    -
    AltA
    Query:1TCTTGCCTACTCCTCCCATT20
    | | | | | | | : | | | | | | * | | | | |
    Sbjct:161AGAACGGGTGAGGAAGGTAA142
    TCTTGCCTACTCCTCCCATT
    psRobot
    TMV resistance N-like
    9
    ptc-miR482a.1
    1.5
    Chr10:21293741-21293757|ptc-miR482a.1|Chr10:21293602-21294476
    Potri.010G231200
    -
    AltA
    Query:1CCTACTCCTCCCATTCC17
    | | : | | | | | | * | | | | | | |
    Sbjct:156GGGTGAGGAAGGTAAGG140
    CCTACTCCTCCCATTCC
    psRobot
    TMV resistance N-like
    10
    ptc-miR160b-3p;ptc-miR160c-3p
    3.0
    Chr10:16974109-16974128|ptc-miR160b-3p;ptc-miR160c-3p|Chr10:16973591-16975061
    Potri.010G166500
    -
    IntronR
    Query:1GCGTATGAGGAGCCATGCATA21
    | * | | | | | | : | | | | | | | : * * | |
    Sbjct:538CACATACTTCTCGGTAT-AAT519
    GCGTATGAGGAGCCATGCATA
    psRobot
    uncharacterized endoplasmic reticulum membrane -like
    11
    ptc-miR1444b;ptc-miR1444c
    4.5
    Chr10:20705687-20705706|ptc-miR1444b;ptc-miR1444c|Chr10:20705350-20706316
    Potri.010G222800
    -
    IntronR
    CAACATTGAACGAAAGTGAG

    TTCACATTCGGTCAACGTTC
    miRferno
    nudix family [Populus trichocarpa]
    12
    ptc-miR6451
    3.0
    Chr10:18552669-18552689|ptc-miR6451|Chr10:18552523-18553281
    Potri.010G190100
    -
    IntronR
    Query:1ATGTCAGATCATGTTAGGTAT21
    | | | | | | | * | | | | | : | | : * | * |
    Sbjct:167TACAGTCCAGTACGATTAAAA147
    ATGTCAGATCATGTTAGGTAT
    psRobot
    arginyl-tRNA-- transferase 1 isoform X1
    13
    ptc-miR6451
    3.0
    Chr10:18552722-18552742|ptc-miR6451|Chr10:18552523-18553334
    Potri.010G190100
    -
    IntronR
    Query:1ATGTCAGATCATGTTAGGTAT21
    | | | | | | | * | | | | | : | | : * | * |
    Sbjct:220TACAGTCCAGTACGATTAAAA200
    ATGTCAGATCATGTTAGGTAT
    psRobot
    arginyl-tRNA-- transferase 1 isoform X1
    14
    ptc-miR530b
    4.0
    Chr10:18555619-18555638|ptc-miR530b|Chr10:18554894-18556003
    Potri.010G190100
    -
    ExonS
    AGGATGCAAGTCGAAGTGCA

    TGCATTTGCACCTGCATCTT
    miRferno
    arginyl-tRNA-- transferase 1 isoform X1
    15
    ptc-miR6451
    5.0
    Chr10:18553115-18553135|ptc-miR6451|Chr10:18552523-18553281
    Potri.010G190100
    -
    IntronR
    AAAATTAGCATGACCTGACAT

    ATGTCAGATCATGTTAGGTAT
    miRferno
    arginyl-tRNA-- transferase 1 isoform X1
    16
    ptc-miR6451
    5.0
    Chr10:18553115-18553135|ptc-miR6451|Chr10:18552523-18553334
    Potri.010G190100
    -
    IntronR
    AAAATTAGCATGACCTGACAT

    ATGTCAGATCATGTTAGGTAT
    miRferno
    arginyl-tRNA-- transferase 1 isoform X1
    17
    ptc-miR472b
    4.5
    Chr10:6122402-6122423|ptc-miR472b|Chr10:6121845-6122821
    Potri.010G035100
    -
    IntronR
    TGGATGGATGGACTTGGGGATA

    TTTTCCCAACTCCACCCATCCC
    miRferno
    Actin cross-linking [Theobroma cacao]
    18
    ptc-miR6425a-3p;ptc-miR6425b-3p;ptc-miR6425c-3p;pt
    3.0
    Chr10:21878178-21878198|ptc-miR6425a-3p;ptc-miR6425b-3p;ptc-miR6425c-3p;ptc-miR6425d-3p|Chr10:21877952-21878714
    Potri.010G242100
    +
    IntronR
    Query:1TCCATGGAAGATAATGACTCG21
    * | | | | | | | | | | | | | : : | * | * *
    Sbjct:247CGGTACCTTCTATTGTTCAAA227
    TCCATGGAAGATAATGACTCG
    psRobot
    nudix hydrolase chloroplastic
    19
    ptc-miR7813
    2.5
    Chr10:6043573-6043592|ptc-miR7813|Chr10:6043489-6043599
    Potri.010G034800
    -
    ExonS
    Query:1TGGTAATGCAAGTGTTGCTAA21
    * | | | | | | : | | | : | : | | | | * | |
    Sbjct:104TCCATTATGTTTATAACG-TT85
    TGGTAATGCAAGTGTTGCTAA
    psRobot
    AMP deaminase-like
    20
    ptc-miR7813
    2.5
    Chr10:6043575-6043594|ptc-miR7813|Chr10:6043489-6043601
    Potri.010G034800
    -
    ExonS
    Query:1TGGTAATGCAAGTGTTGCTAA21
    * | | | | | | : | | | : | : | | | | * | |
    Sbjct:106TCCATTATGTTTATAACG-TT87
    TGGTAATGCAAGTGTTGCTAA
    psRobot
    AMP deaminase-like
    21
    ptc-miR530b
    5
    Chr10:15771794-15771813|ptc-miR530b|Chr10:15771373-15772201
    Potri.010G148600
    -
    IntronR
    AACATGAAGGTAAATATGCA

    TGCATTTGCACCTGCATCTT
    miRferno
    ER membrane complex subunit 6
    22
    ptc-miR6459b
    4.0
    Chr10:19712373-19712392|ptc-miR6459b|Chr10:19712246-19712818
    Potri.010G206800
    +
    AltD
    GGTAGGATTTTGGCTTGATA

    TCTCAAGCCCAAATTCGATC
    miRferno
    Ubiquitin-conjugating enzyme E2 7 family [Populus trichocarpa]
    23
    ptc-miR7825
    3.0
    Chr10:312745-312766|ptc-miR7825|Chr10:312739-313432
    Potri.010G003300
    -
    AltD
    Query:1TTGAAGAAAGGTAGACAGATAG22
    | | | | | | | | | | : | | : | * | | | * * |
    Sbjct:28AACTTCTTTCTATTTCTCTTAC7
    TTGAAGAAAGGTAGACAGATAG
    psRobot
    SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A 1
    24
    ptc-miR7825
    3.0
    Chr10:312675-312696|ptc-miR7825|Chr10:312668-313433
    Potri.010G003300
    -
    IntronR
    Query:1TTGAAGAAAGGTAGACAGATAG22
    | | | | | | | | | | : | | : | * | | | * * |
    Sbjct:29AACTTCTTTCTATTTCTCTTAC8
    TTGAAGAAAGGTAGACAGATAG
    psRobot
    SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A 1
    25
    ptc-miR7825
    3.0
    Chr10:312815-312836|ptc-miR7825|Chr10:312808-313433
    Potri.010G003300
    -
    IntronR
    Query:1TTGAAGAAAGGTAGACAGATAG22
    | | | | | | | | | | : | | : | * | | | * * |
    Sbjct:29AACTTCTTTCTATTTCTCTTAC8
    TTGAAGAAAGGTAGACAGATAG
    psRobot
    SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A 1
    26
    ptc-miR7825
    4.0
    Chr10:313405-313426|ptc-miR7825|Chr10:312808-313433
    Potri.010G003300
    -
    IntronR
    CATTCTCTTTATCTTTCTTCAA

    TTGAAGAAAGGTAGACAGATAG
    miRferno
    SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A 1
    27
    ptc-miR7825
    4.0
    Chr10:313405-313426|ptc-miR7825|Chr10:312739-313432
    Potri.010G003300
    -
    AltD
    CATTCTCTTTATCTTTCTTCAA

    TTGAAGAAAGGTAGACAGATAG
    miRferno
    SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A 1
    28
    ptc-miR7825
    4.0
    Chr10:313405-313426|ptc-miR7825|Chr10:312668-313433
    Potri.010G003300
    -
    IntronR
    CATTCTCTTTATCTTTCTTCAA

    TTGAAGAAAGGTAGACAGATAG
    miRferno
    SWI SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A 1
    29
    ptc-miR168a-3p;ptc-miR168b-3p
    4.5
    Chr10:10994323-10994343|ptc-miR168a-3p;ptc-miR168b-3p|Chr10:10994113-10994749
    Potri.010G084100
    -
    AltA
    TTTTAGCTGATGCAAGAAGGG

    CCCGCCTTGCATCAACTGAAT
    miRferno
    ATP-dependent RNA helicase mitochondrial isoform X2
    30
    ptc-miR168a-3p;ptc-miR168b-3p
    4.5
    Chr10:10994323-10994343|ptc-miR168a-3p;ptc-miR168b-3p|Chr10:10994127-10994749
    Potri.010G084100
    -
    AltA
    TTTTAGCTGATGCAAGAAGGG

    CCCGCCTTGCATCAACTGAAT
    miRferno
    ATP-dependent RNA helicase mitochondrial isoform X2