Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Sorghum bicolor

Total 10101 records in 337 Pages. Current page: 1
1/337 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
sbi-miR5570
3.0
chr6:59750269-59750288|miR5570|chr6:59749920-59750
Sb06g031353
-
AltD
Query:1AAAAGACAAATCAGCATGTCA21
| | | | * | | | | | | | | | * | | * | | *
Sbjct:369TTTTGTGTTTAGTCTTA-AGA350
AAAAGACAAATCAGCATGTCA
psRobot
metal-dependent phosphohydrolase HD domain-containing protein
2
sbi-miR5570
3.0
chr6:59750331-59750350|miR5570|chr6:59749920-59750
Sb06g031353
-
ExonS
Query:1AAAAGACAAATCAGCATGTCA21
| | | | * | | | | | | | | | * | | * | | *
Sbjct:431TTTTGTGTTTAGTCTTA-AGA412
AAAAGACAAATCAGCATGTCA
psRobot
metal-dependent phosphohydrolase HD domain-containing protein
3
sbi-miR5570
3.0
chr6:59750346-59750365|miR5570|chr6:59749996-59750
Sb06g031353
-
IntronR
Query:1AAAAGACAAATCAGCATGTCA21
| | | | * | | | | | | | | | * | | * | | *
Sbjct:370TTTTGTGTTTAGTCTTA-AGA351
AAAAGACAAATCAGCATGTCA
psRobot
metal-dependent phosphohydrolase HD domain-containing protein
4
sbi-miR5570
3.0
chr6:59750352-59750371|miR5570|chr6:59749996-59750
Sb06g031353
-
IntronR
Query:1AAAAGACAAATCAGCATGTCA21
| | | | * | | | | | | | | | * | | * | | *
Sbjct:376TTTTGTGTTTAGTCTTA-AGA357
AAAAGACAAATCAGCATGTCA
psRobot
metal-dependent phosphohydrolase HD domain-containing protein
5
sbi-miR5570
3.0
chr6:59750407-59750426|miR5570|chr6:59749996-59750
Sb06g031353
-
AltA
Query:1AAAAGACAAATCAGCATGTCA21
| | | | * | | | | | | | | | * | | * | | *
Sbjct:431TTTTGTGTTTAGTCTTA-AGA412
AAAAGACAAATCAGCATGTCA
psRobot
metal-dependent phosphohydrolase HD domain-containing protein
6
sbi-miR5570
3.0
chr6:59750345-59750364|miR5570|chr6:59749989-59750
Sb06g031353
-
IntronR
Query:1AAAAGACAAATCAGCATGTCA21
| | | | * | | | | | | | | | * | | * | | *
Sbjct:376TTTTGTGTTTAGTCTTA-AGA357
AAAAGACAAATCAGCATGTCA
psRobot
metal-dependent phosphohydrolase HD domain-containing protein
7
sbi-miR5570
3.0
chr6:59750275-59750294|miR5570|chr6:59749920-59750
Sb06g031353
-
AltD
Query:1AAAAGACAAATCAGCATGTCA21
| | | | * | | | | | | | | | * | | * | | *
Sbjct:375TTTTGTGTTTAGTCTTA-AGA356
AAAAGACAAATCAGCATGTCA
psRobot
metal-dependent phosphohydrolase HD domain-containing protein
8
sbi-miR5565e
3.0
chr3:54905055-54905073|miR5565e|chr3:54905019-5490
Sb03g027390
-
IntronR
Query:1TTGTTTGGATGTTGTCGGA19
| | : * : | | | | | * | | | | | | | |
Sbjct:55AATCGACCTAAAACAGCCT37
TTGTTTGGATGTTGTCGGA
psRobot
LUG (LEUNIG); protein binding / protein heterodimerization/ transcription repressor
9
sbi-miR396b,sbi-miR396a
2.8
chr10:2286120-2286139|miR396b,miR396a|chr10:228529
Sb10g002590
+
AltD
Query:1TTCCACAGCTTTCTTGAACTG21
: | | | | | | | * | | | * | | | | * | | |
Sbjct:843GAGGTGTCAAAAAAACT-GAC824
TTCCACAGCTTTCTTGAACTG
psRobot
lectin protein kinase family protein
10
sbi-miR156a,sbi-miR156b,sbi-miR156h,sbi-miR156i,sb
3.0
chr1:22997655-22997674|miR156a,miR156b,miR156h,miR
Sb01g020480
-
ExonS
Query:1TGACAGAAGAGAGTGAGCAC20
| | | | | | | | | | | | : : | | * * * |
Sbjct:30ACTGTCTTCTCTTGCTGCCG11
TGACAGAAGAGAGTGAGCAC
psRobot
transmembrane protein-related
11
sbi-miR156e
2.5
chr1:22997655-22997674|miR156e|chr1:22997645-22997
Sb01g020480
-
ExonS
Query:1TGACAGAAGAGAGCGAGCAC20
| | | | | | | | | | | | : | | | * * * |
Sbjct:30ACTGTCTTCTCTTGCTGCCG11
TGACAGAAGAGAGCGAGCAC
psRobot
transmembrane protein-related
12
sbi-miR5568c-3p
3.0
chr1:54536622-54536642|miR5568c-3p|chr1:54536192-5
Sb01g031820
+
IntronR
Query:1ACTTACAGTTTGGAACGGAGG21
| | : | | | | | : | | | : | | | : : * : |
Sbjct:451TGGATGTCGAACTTTGTTGTC431
ACTTACAGTTTGGAACGGAGG
psRobot
leucine-rich repeat protein, putative
13
sbi-miR399i,sbi-miR399d
3.0
chr3:65458940-65458960|miR399i,miR399d|chr3:654587
Sb03g037540
+
IntronR
Query:1TGCCAAAGGAGAGTTGCCCTG21
| | | | | | | | | | | * | | | * | | * | *
Sbjct:246ACGGTTTCCTCACAAAGGCAG226
TGCCAAAGGAGAGTTGCCCTG
psRobot
disease resistance protein (NBS-LRR class), putative
14
sbi-miR5568f-5p
3.0
chr7:30865197-30865217|miR5568f-5p|chr7:30865169-3
Sb07g013790
-
ExonS
Query:1TCCATTCCAAATTGTAAGATG21
| | | * | | | | | | | | | : | * | | * | |
Sbjct:49AGGCAAGGTTTAATAATCAAC29
TCCATTCCAAATTGTAAGATG
psRobot
unknown protein
15
sbi-miR5568f-5p
3.0
chr7:30865273-30865293|miR5568f-5p|chr7:30865245-3
Sb07g013790
-
AltA
Query:1TCCATTCCAAATTGTAAGATG21
| | | * | | | | | | | | | : | * | | * | |
Sbjct:49AGGCAAGGTTTAATAATCAAC29
TCCATTCCAAATTGTAAGATG
psRobot
unknown protein
16
sbi-miR5570
3.0
chr1:55217623-55217642|miR5570|chr1:55217076-55217
Sb01g032320
+
IntronR
Query:1AAAAGACAAATCAGCATGTCA21
| * | | : | | | | | | | | : | | | | * * |
Sbjct:567TGTTTTGTTTAGTTGTAC-CT548
AAAAGACAAATCAGCATGTCA
psRobot
WAKL5 (wall associated kinase-like 5); kinase
17
sbi-miR5565e
3.0
chr7:56134914-56134932|miR5565e|chr7:56133404-5613
Sb07g021900
+
AltD
Query:1TTGTTTGGATGTTGTCGGA19
| | | | | | | * | | * | | | | | | * *
Sbjct:1529AACAAACGTAAAACAGCAG1511
TTGTTTGGATGTTGTCGGA
psRobot
Sb07g021900.1
18
sbi-miR5570
3.0
chr4:7069973-7069992|miR5570|chr4:7066279-7070300
Sb04g006970
-
IntronR
Query:1AAAAGACAAATCAGCATGTCA21
| * | | | | | | | | : | | | | | * | | * |
Sbjct:3714TGTTCTGTTTGGTCGTTCA-T3695
AAAAGACAAATCAGCATGTCA
psRobot
SHN1 (SHINE 1); DNA binding / sequence-specific DNA binding / transcription factor
19
sbi-miR5570
3.0
chr4:7069905-7069924|miR5570|chr4:7066212-7070299
Sb04g006970
-
AltD
Query:1AAAAGACAAATCAGCATGTCA21
| * | | | | | | | | : | | | | | * | | * |
Sbjct:3713TGTTCTGTTTGGTCGTTCA-T3694
AAAAGACAAATCAGCATGTCA
psRobot
SHN1 (SHINE 1); DNA binding / sequence-specific DNA binding / transcription factor
20
sbi-miR5570
3.0
chr4:7068535-7068554|miR5570|chr4:7066279-7068862
Sb04g006970
-
AltA
Query:1AAAAGACAAATCAGCATGTCA21
| * | | | | | | | | : | | | | | * | | * |
Sbjct:2276TGTTCTGTTTGGTCGTTCA-T2257
AAAAGACAAATCAGCATGTCA
psRobot
SHN1 (SHINE 1); DNA binding / sequence-specific DNA binding / transcription factor
21
sbi-miR5570
3.0
chr4:7068468-7068487|miR5570|chr4:7066212-7068862
Sb04g006970
-
ExonS
Query:1AAAAGACAAATCAGCATGTCA21
| * | | | | | | | | : | | | | | * | | * |
Sbjct:2276TGTTCTGTTTGGTCGTTCA-T2257
AAAAGACAAATCAGCATGTCA
psRobot
SHN1 (SHINE 1); DNA binding / sequence-specific DNA binding / transcription factor
22
sbi-miR5568a
2.8
chr1:59979234-59979254|miR5568a|chr1:59978546-5997
Sb01g036360
-
IntronR
Query:1CAGAGCGACTTACAATTTGGA21
* | | | : | | | | * | | | | | | : | : | |
Sbjct:709ATCTTGCTGTATGTTAGATCT689
CAGAGCGACTTACAATTTGGA
psRobot
CYP714A1; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding
23
sbi-miR5568f-5p
2.0
chr1:59979317-59979337|miR5568f-5p|chr1:59978546-5
Sb01g036360
-
IntronR
Query:1TCCATTCCAAATTGTAAGATG21
| | | | | | * | | | | | | | : | | | * | |
Sbjct:792AGGTAACGTTTAACGTTCAAC772
TCCATTCCAAATTGTAAGATG
psRobot
CYP714A1; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding
24
sbi-miR319b,sbi-miR319a
3.0
chr1:59978477-59978496|miR319b,miR319a|chr1:599783
Sb01g036360
+
ExonS
Query:1TTGGACTGAAGGGTGCTCCC20
| | | | | | | * * | | | : | | | : | | |
Sbjct:163AACCTGAACTCCTACGGGGG144
TTGGACTGAAGGGTGCTCCC
psRobot
CYP714A1; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding
25
sbi-miR319b,sbi-miR319a
3.0
chr1:59978477-59978496|miR319b,miR319a|chr1:599783
Sb01g036360
+
ExonS
Query:1TTGGACTGAAGGGTGCTCCC20
| | | | | | | * * | | | : | | | : | | |
Sbjct:163AACCTGAACTCCTACGGGGG144
TTGGACTGAAGGGTGCTCCC
psRobot
CYP714A1; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding
26
sbi-miR5568f-5p
0.5
chr1:3413181-3413201|miR5568f-5p|chr1:3412938-3414
Sb01g004260
+
IntronR
Query:1TCCATTCCAAATTGTAAGATG21
| | | | | | | | | | | | | | | | | | | : :
Sbjct:264AGGTAAGGTTTAACATTCTGT244
TCCATTCCAAATTGTAAGATG
psRobot
40S ribosomal protein S2 (RPS2D)
27
sbi-miR5568f-5p
0.5
chr1:3413181-3413201|miR5568f-5p|chr1:3411826-3414
Sb01g004260
+
IntronR
Query:1TCCATTCCAAATTGTAAGATG21
| | | | | | | | | | | | | | | | | | | : :
Sbjct:1376AGGTAAGGTTTAACATTCTGT1356
TCCATTCCAAATTGTAAGATG
psRobot
40S ribosomal protein S2 (RPS2D)
28
sbi-miR5568f-5p
0.5
chr1:3413181-3413201|miR5568f-5p|chr1:3412938-3414
Sb01g004260
+
IntronR
Query:1TCCATTCCAAATTGTAAGATG21
| | | | | | | | | | | | | | | | | | | : :
Sbjct:264AGGTAAGGTTTAACATTCTGT244
TCCATTCCAAATTGTAAGATG
psRobot
40S ribosomal protein S2 (RPS2D)
29
sbi-miR5568f-5p
0.5
chr1:3413181-3413201|miR5568f-5p|chr1:3412363-3414
Sb01g004260
+
AltA
Query:1TCCATTCCAAATTGTAAGATG21
| | | | | | | | | | | | | | | | | | | : :
Sbjct:839AGGTAAGGTTTAACATTCTGT819
TCCATTCCAAATTGTAAGATG
psRobot
40S ribosomal protein S2 (RPS2D)
30
sbi-miR5568f-5p
0.5
chr1:3413181-3413201|miR5568f-5p|chr1:3412491-3414
Sb01g004260
+
IntronR
Query:1TCCATTCCAAATTGTAAGATG21
| | | | | | | | | | | | | | | | | | | : :
Sbjct:711AGGTAAGGTTTAACATTCTGT691
TCCATTCCAAATTGTAAGATG
psRobot
40S ribosomal protein S2 (RPS2D)
IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/337 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>