Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Sorghum bicolor

Total 10101 records in 337 Pages. Current page: 1
1/337 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    sbi-miR5570
    3.0
    chr6:59750269-59750288|miR5570|chr6:59749920-59750
    Sb06g031353
    -
    AltD
    Query:1AAAAGACAAATCAGCATGTCA21
    | | | | * | | | | | | | | | * | | * | | *
    Sbjct:369TTTTGTGTTTAGTCTTA-AGA350
    AAAAGACAAATCAGCATGTCA
    psRobot
    metal-dependent phosphohydrolase HD domain-containing protein
    2
    sbi-miR5570
    3.0
    chr6:59750331-59750350|miR5570|chr6:59749920-59750
    Sb06g031353
    -
    ExonS
    Query:1AAAAGACAAATCAGCATGTCA21
    | | | | * | | | | | | | | | * | | * | | *
    Sbjct:431TTTTGTGTTTAGTCTTA-AGA412
    AAAAGACAAATCAGCATGTCA
    psRobot
    metal-dependent phosphohydrolase HD domain-containing protein
    3
    sbi-miR5570
    3.0
    chr6:59750346-59750365|miR5570|chr6:59749996-59750
    Sb06g031353
    -
    IntronR
    Query:1AAAAGACAAATCAGCATGTCA21
    | | | | * | | | | | | | | | * | | * | | *
    Sbjct:370TTTTGTGTTTAGTCTTA-AGA351
    AAAAGACAAATCAGCATGTCA
    psRobot
    metal-dependent phosphohydrolase HD domain-containing protein
    4
    sbi-miR5570
    3.0
    chr6:59750352-59750371|miR5570|chr6:59749996-59750
    Sb06g031353
    -
    IntronR
    Query:1AAAAGACAAATCAGCATGTCA21
    | | | | * | | | | | | | | | * | | * | | *
    Sbjct:376TTTTGTGTTTAGTCTTA-AGA357
    AAAAGACAAATCAGCATGTCA
    psRobot
    metal-dependent phosphohydrolase HD domain-containing protein
    5
    sbi-miR5570
    3.0
    chr6:59750407-59750426|miR5570|chr6:59749996-59750
    Sb06g031353
    -
    AltA
    Query:1AAAAGACAAATCAGCATGTCA21
    | | | | * | | | | | | | | | * | | * | | *
    Sbjct:431TTTTGTGTTTAGTCTTA-AGA412
    AAAAGACAAATCAGCATGTCA
    psRobot
    metal-dependent phosphohydrolase HD domain-containing protein
    6
    sbi-miR5570
    3.0
    chr6:59750345-59750364|miR5570|chr6:59749989-59750
    Sb06g031353
    -
    IntronR
    Query:1AAAAGACAAATCAGCATGTCA21
    | | | | * | | | | | | | | | * | | * | | *
    Sbjct:376TTTTGTGTTTAGTCTTA-AGA357
    AAAAGACAAATCAGCATGTCA
    psRobot
    metal-dependent phosphohydrolase HD domain-containing protein
    7
    sbi-miR5570
    3.0
    chr6:59750275-59750294|miR5570|chr6:59749920-59750
    Sb06g031353
    -
    AltD
    Query:1AAAAGACAAATCAGCATGTCA21
    | | | | * | | | | | | | | | * | | * | | *
    Sbjct:375TTTTGTGTTTAGTCTTA-AGA356
    AAAAGACAAATCAGCATGTCA
    psRobot
    metal-dependent phosphohydrolase HD domain-containing protein
    8
    sbi-miR5565e
    3.0
    chr3:54905055-54905073|miR5565e|chr3:54905019-5490
    Sb03g027390
    -
    IntronR
    Query:1TTGTTTGGATGTTGTCGGA19
    | | : * : | | | | | * | | | | | | | |
    Sbjct:55AATCGACCTAAAACAGCCT37
    TTGTTTGGATGTTGTCGGA
    psRobot
    LUG (LEUNIG); protein binding / protein heterodimerization/ transcription repressor
    9
    sbi-miR396b,sbi-miR396a
    2.8
    chr10:2286120-2286139|miR396b,miR396a|chr10:228529
    Sb10g002590
    +
    AltD
    Query:1TTCCACAGCTTTCTTGAACTG21
    : | | | | | | | * | | | * | | | | * | | |
    Sbjct:843GAGGTGTCAAAAAAACT-GAC824
    TTCCACAGCTTTCTTGAACTG
    psRobot
    lectin protein kinase family protein
    10
    sbi-miR156a,sbi-miR156b,sbi-miR156h,sbi-miR156i,sb
    3.0
    chr1:22997655-22997674|miR156a,miR156b,miR156h,miR
    Sb01g020480
    -
    ExonS
    Query:1TGACAGAAGAGAGTGAGCAC20
    | | | | | | | | | | | | : : | | * * * |
    Sbjct:30ACTGTCTTCTCTTGCTGCCG11
    TGACAGAAGAGAGTGAGCAC
    psRobot
    transmembrane protein-related
    11
    sbi-miR156e
    2.5
    chr1:22997655-22997674|miR156e|chr1:22997645-22997
    Sb01g020480
    -
    ExonS
    Query:1TGACAGAAGAGAGCGAGCAC20
    | | | | | | | | | | | | : | | | * * * |
    Sbjct:30ACTGTCTTCTCTTGCTGCCG11
    TGACAGAAGAGAGCGAGCAC
    psRobot
    transmembrane protein-related
    12
    sbi-miR5568c-3p
    3.0
    chr1:54536622-54536642|miR5568c-3p|chr1:54536192-5
    Sb01g031820
    +
    IntronR
    Query:1ACTTACAGTTTGGAACGGAGG21
    | | : | | | | | : | | | : | | | : : * : |
    Sbjct:451TGGATGTCGAACTTTGTTGTC431
    ACTTACAGTTTGGAACGGAGG
    psRobot
    leucine-rich repeat protein, putative
    13
    sbi-miR399i,sbi-miR399d
    3.0
    chr3:65458940-65458960|miR399i,miR399d|chr3:654587
    Sb03g037540
    +
    IntronR
    Query:1TGCCAAAGGAGAGTTGCCCTG21
    | | | | | | | | | | | * | | | * | | * | *
    Sbjct:246ACGGTTTCCTCACAAAGGCAG226
    TGCCAAAGGAGAGTTGCCCTG
    psRobot
    disease resistance protein (NBS-LRR class), putative
    14
    sbi-miR5568f-5p
    3.0
    chr7:30865197-30865217|miR5568f-5p|chr7:30865169-3
    Sb07g013790
    -
    ExonS
    Query:1TCCATTCCAAATTGTAAGATG21
    | | | * | | | | | | | | | : | * | | * | |
    Sbjct:49AGGCAAGGTTTAATAATCAAC29
    TCCATTCCAAATTGTAAGATG
    psRobot
    unknown protein
    15
    sbi-miR5568f-5p
    3.0
    chr7:30865273-30865293|miR5568f-5p|chr7:30865245-3
    Sb07g013790
    -
    AltA
    Query:1TCCATTCCAAATTGTAAGATG21
    | | | * | | | | | | | | | : | * | | * | |
    Sbjct:49AGGCAAGGTTTAATAATCAAC29
    TCCATTCCAAATTGTAAGATG
    psRobot
    unknown protein
    16
    sbi-miR5570
    3.0
    chr1:55217623-55217642|miR5570|chr1:55217076-55217
    Sb01g032320
    +
    IntronR
    Query:1AAAAGACAAATCAGCATGTCA21
    | * | | : | | | | | | | | : | | | | * * |
    Sbjct:567TGTTTTGTTTAGTTGTAC-CT548
    AAAAGACAAATCAGCATGTCA
    psRobot
    WAKL5 (wall associated kinase-like 5); kinase
    17
    sbi-miR5565e
    3.0
    chr7:56134914-56134932|miR5565e|chr7:56133404-5613
    Sb07g021900
    +
    AltD
    Query:1TTGTTTGGATGTTGTCGGA19
    | | | | | | | * | | * | | | | | | * *
    Sbjct:1529AACAAACGTAAAACAGCAG1511
    TTGTTTGGATGTTGTCGGA
    psRobot
    Sb07g021900.1
    18
    sbi-miR5570
    3.0
    chr4:7069973-7069992|miR5570|chr4:7066279-7070300
    Sb04g006970
    -
    IntronR
    Query:1AAAAGACAAATCAGCATGTCA21
    | * | | | | | | | | : | | | | | * | | * |
    Sbjct:3714TGTTCTGTTTGGTCGTTCA-T3695
    AAAAGACAAATCAGCATGTCA
    psRobot
    SHN1 (SHINE 1); DNA binding / sequence-specific DNA binding / transcription factor
    19
    sbi-miR5570
    3.0
    chr4:7069905-7069924|miR5570|chr4:7066212-7070299
    Sb04g006970
    -
    AltD
    Query:1AAAAGACAAATCAGCATGTCA21
    | * | | | | | | | | : | | | | | * | | * |
    Sbjct:3713TGTTCTGTTTGGTCGTTCA-T3694
    AAAAGACAAATCAGCATGTCA
    psRobot
    SHN1 (SHINE 1); DNA binding / sequence-specific DNA binding / transcription factor
    20
    sbi-miR5570
    3.0
    chr4:7068535-7068554|miR5570|chr4:7066279-7068862
    Sb04g006970
    -
    AltA
    Query:1AAAAGACAAATCAGCATGTCA21
    | * | | | | | | | | : | | | | | * | | * |
    Sbjct:2276TGTTCTGTTTGGTCGTTCA-T2257
    AAAAGACAAATCAGCATGTCA
    psRobot
    SHN1 (SHINE 1); DNA binding / sequence-specific DNA binding / transcription factor
    21
    sbi-miR5570
    3.0
    chr4:7068468-7068487|miR5570|chr4:7066212-7068862
    Sb04g006970
    -
    ExonS
    Query:1AAAAGACAAATCAGCATGTCA21
    | * | | | | | | | | : | | | | | * | | * |
    Sbjct:2276TGTTCTGTTTGGTCGTTCA-T2257
    AAAAGACAAATCAGCATGTCA
    psRobot
    SHN1 (SHINE 1); DNA binding / sequence-specific DNA binding / transcription factor
    22
    sbi-miR5568a
    2.8
    chr1:59979234-59979254|miR5568a|chr1:59978546-5997
    Sb01g036360
    -
    IntronR
    Query:1CAGAGCGACTTACAATTTGGA21
    * | | | : | | | | * | | | | | | : | : | |
    Sbjct:709ATCTTGCTGTATGTTAGATCT689
    CAGAGCGACTTACAATTTGGA
    psRobot
    CYP714A1; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding
    23
    sbi-miR5568f-5p
    2.0
    chr1:59979317-59979337|miR5568f-5p|chr1:59978546-5
    Sb01g036360
    -
    IntronR
    Query:1TCCATTCCAAATTGTAAGATG21
    | | | | | | * | | | | | | | : | | | * | |
    Sbjct:792AGGTAACGTTTAACGTTCAAC772
    TCCATTCCAAATTGTAAGATG
    psRobot
    CYP714A1; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding
    24
    sbi-miR319b,sbi-miR319a
    3.0
    chr1:59978477-59978496|miR319b,miR319a|chr1:599783
    Sb01g036360
    +
    ExonS
    Query:1TTGGACTGAAGGGTGCTCCC20
    | | | | | | | * * | | | : | | | : | | |
    Sbjct:163AACCTGAACTCCTACGGGGG144
    TTGGACTGAAGGGTGCTCCC
    psRobot
    CYP714A1; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding
    25
    sbi-miR319b,sbi-miR319a
    3.0
    chr1:59978477-59978496|miR319b,miR319a|chr1:599783
    Sb01g036360
    +
    ExonS
    Query:1TTGGACTGAAGGGTGCTCCC20
    | | | | | | | * * | | | : | | | : | | |
    Sbjct:163AACCTGAACTCCTACGGGGG144
    TTGGACTGAAGGGTGCTCCC
    psRobot
    CYP714A1; electron carrier/ heme binding / iron ion binding / monooxygenase/ oxygen binding
    26
    sbi-miR5568f-5p
    0.5
    chr1:3413181-3413201|miR5568f-5p|chr1:3412938-3414
    Sb01g004260
    +
    IntronR
    Query:1TCCATTCCAAATTGTAAGATG21
    | | | | | | | | | | | | | | | | | | | : :
    Sbjct:264AGGTAAGGTTTAACATTCTGT244
    TCCATTCCAAATTGTAAGATG
    psRobot
    40S ribosomal protein S2 (RPS2D)
    27
    sbi-miR5568f-5p
    0.5
    chr1:3413181-3413201|miR5568f-5p|chr1:3411826-3414
    Sb01g004260
    +
    IntronR
    Query:1TCCATTCCAAATTGTAAGATG21
    | | | | | | | | | | | | | | | | | | | : :
    Sbjct:1376AGGTAAGGTTTAACATTCTGT1356
    TCCATTCCAAATTGTAAGATG
    psRobot
    40S ribosomal protein S2 (RPS2D)
    28
    sbi-miR5568f-5p
    0.5
    chr1:3413181-3413201|miR5568f-5p|chr1:3412938-3414
    Sb01g004260
    +
    IntronR
    Query:1TCCATTCCAAATTGTAAGATG21
    | | | | | | | | | | | | | | | | | | | : :
    Sbjct:264AGGTAAGGTTTAACATTCTGT244
    TCCATTCCAAATTGTAAGATG
    psRobot
    40S ribosomal protein S2 (RPS2D)
    29
    sbi-miR5568f-5p
    0.5
    chr1:3413181-3413201|miR5568f-5p|chr1:3412363-3414
    Sb01g004260
    +
    AltA
    Query:1TCCATTCCAAATTGTAAGATG21
    | | | | | | | | | | | | | | | | | | | : :
    Sbjct:839AGGTAAGGTTTAACATTCTGT819
    TCCATTCCAAATTGTAAGATG
    psRobot
    40S ribosomal protein S2 (RPS2D)
    30
    sbi-miR5568f-5p
    0.5
    chr1:3413181-3413201|miR5568f-5p|chr1:3412491-3414
    Sb01g004260
    +
    IntronR
    Query:1TCCATTCCAAATTGTAAGATG21
    | | | | | | | | | | | | | | | | | | | : :
    Sbjct:711AGGTAAGGTTTAACATTCTGT691
    TCCATTCCAAATTGTAAGATG
    psRobot
    40S ribosomal protein S2 (RPS2D)