Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Solanum lycopersicum

Total 1573 records in 53 Pages. Current page: 1
1/53 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    sly-miR5303
    1.5
    ch11:3112009-3112029|miR5303|ch11:3111863-3112133
    Solyc11g008960.1
    -
    AltD
    Query:1TTTTTGAAGAGTTCGAGCAAC21
    | | | | | | | | : | | | : | | | | * | | |
    Sbjct:167AAAAACTTTTCAGGCTCATTG147
    TTTTTGAAGAGTTCGAGCAAC
    psRobot
    Receptor like kinase, RLK
    2
    sly-miR5303
    2.0
    ch11:3111967-3111987|miR5303|ch11:3111863-3112133
    Solyc11g008960.1
    -
    AltD
    GTTACTCGGACTTTTCAAAAA

    TTTTTGAAGAGTTCGAGCAAC
    miRferno
    Receptor like kinase, RLK
    3
    sly-miR390a-5p
    5.5
    ch02:41643615-41643635|miR390a-5p|ch02:41642884-41
    Solyc02g072440.2
    +
    IntronR
    GGTTCTTTACCTCCTGATTTT

    AAGCTCAGGAGGGATAGCACC
    miRferno
    Receptor like kinase, RLK
    4
    sly-miR5303
    3.0
    ch01:2986768-2986788|miR5303|ch01:2986338-2987063
    Solyc01g008970.2
    -
    IntronR
    Query:1TTTTTGAAGAGTTCGAGCAAC21
    | | | | | | | | | | : : : | | * | | | * |
    Sbjct:451AAAAACTTCTTGGGCACGTCG431
    TTTTTGAAGAGTTCGAGCAAC
    psRobot
    Heterogeneous nuclear ribonucleoprotein A3-like protein 2 (B6TV58_MAIZE)
    5
    sly-miR5303
    3.0
    ch01:2986819-2986839|miR5303|ch01:2986389-2987063
    Solyc01g008970.2
    -
    IntronR
    Query:1TTTTTGAAGAGTTCGAGCAAC21
    | | | | | | | | | | : : : | | * | | | * |
    Sbjct:451AAAAACTTCTTGGGCACGTCG431
    TTTTTGAAGAGTTCGAGCAAC
    psRobot
    Heterogeneous nuclear ribonucleoprotein A3-like protein 2 (B6TV58_MAIZE)
    6
    sly-miR5303
    3.5
    ch01:2986613-2986633|miR5303|ch01:2986389-2987063
    Solyc01g008970.2
    -
    IntronR
    GCTGCACGGGTTCTTCAAAAA

    TTTTTGAAGAGTTCGAGCAAC
    miRferno
    Heterogeneous nuclear ribonucleoprotein A3-like protein 2 (B6TV58_MAIZE)
    7
    sly-miR5303
    3.5
    ch01:2986613-2986633|miR5303|ch01:2986338-2987063
    Solyc01g008970.2
    -
    IntronR
    GCTGCACGGGTTCTTCAAAAA

    TTTTTGAAGAGTTCGAGCAAC
    miRferno
    Heterogeneous nuclear ribonucleoprotein A3-like protein 2 (B6TV58_MAIZE)
    8
    sly-miR5303
    3.0
    ch10:2345780-2345800|miR5303|ch10:2343445-2346538
    Solyc10g008240.2
    +
    IntronR
    Query:1TTTTTGAAGAGTTCGAGCAAC21
    | | | : | | | * | | | | * | : | | | | | |
    Sbjct:2356AAAGACTACTCACGTTCGTTG2336
    TTTTTGAAGAGTTCGAGCAAC
    psRobot
    Cc-nbs-lrr, resistance protein
    9
    sly-miR5303
    3.0
    ch10:2345780-2345800|miR5303|ch10:2344348-2346538
    Solyc10g008240.2
    +
    AltA
    Query:1TTTTTGAAGAGTTCGAGCAAC21
    | | | : | | | * | | | | * | : | | | | | |
    Sbjct:1453AAAGACTACTCACGTTCGTTG1433
    TTTTTGAAGAGTTCGAGCAAC
    psRobot
    Cc-nbs-lrr, resistance protein
    10
    sly-miR5303
    3.0
    ch10:2345780-2345800|miR5303|ch10:2343445-2346538
    Solyc10g008240.2
    +
    IntronR
    GTTGCTTGCACTCATCAGAAA

    TTTTTGAAGAGTTCGAGCAAC
    miRferno
    Cc-nbs-lrr, resistance protein
    11
    sly-miR5303
    3.0
    ch10:2345780-2345800|miR5303|ch10:2344348-2346538
    Solyc10g008240.2
    +
    AltA
    GTTGCTTGCACTCATCAGAAA

    TTTTTGAAGAGTTCGAGCAAC
    miRferno
    Cc-nbs-lrr, resistance protein
    12
    sly-miR5303
    5
    ch10:2344655-2344675|miR5303|ch10:2344348-2346538
    Solyc10g008240.2
    +
    AltA
    GTTGATGGACCTCTTCACAAT

    TTTTTGAAGAGTTCGAGCAAC
    miRferno
    Cc-nbs-lrr, resistance protein
    13
    sly-miR5303
    5
    ch10:2344655-2344675|miR5303|ch10:2343445-2346538
    Solyc10g008240.2
    +
    IntronR
    GTTGATGGACCTCTTCACAAT

    TTTTTGAAGAGTTCGAGCAAC
    miRferno
    Cc-nbs-lrr, resistance protein
    14
    sly-miR9470-3p
    5
    ch03:2109158-2109177|miR9470-3p|ch03:2109154-21093
    Solyc03g007530.2
    +
    AltA
    ACTACTATGCATCAGCCAAA

    TTTGGCTCATGGATTTTAGC
    miRferno
    Multidrug resistance protein ABC transporter family (B9GX56_POPTR)
    15
    sly-miR9471b-3p
    3.0
    ch07:47620185-47620204|miR9471b-3p|ch07:47620150-4
    Solyc07g039510.2
    -
    AltA
    Query:1TTGGCTGAGTGAGCATCACTG21
    * | | : | | | * | | | | : | | | | | * | |
    Sbjct:55TACTGACACACTTGTAGT-AC36
    TTGGCTGAGTGAGCATCACTG
    psRobot
    Esterase/lipase/thioesterase (Fragment) (B3VW47_POPTN)
    16
    sly-miR9478-5p
    4.5
    ch02:46770589-46770610|miR9478-5p|ch02:46770167-46
    Solyc02g083320.2
    -
    AltA
    GGTTCTATCTCCATCTTTTAGC

    GCTTAAATATGTAGATCGAACT
    miRferno
    RNA-binding protein (B6JZH8_SCHJY)
    17
    sly-miR9478-5p
    4.5
    ch02:46770589-46770610|miR9478-5p|ch02:46770167-46
    Solyc02g083320.2
    -
    IntronR
    GGTTCTATCTCCATCTTTTAGC

    GCTTAAATATGTAGATCGAACT
    miRferno
    RNA-binding protein (B6JZH8_SCHJY)
    18
    sly-miR9478-5p
    4.5
    ch02:46770589-46770610|miR9478-5p|ch02:46770167-46
    Solyc02g083320.2
    -
    IntronR
    GGTTCTATCTCCATCTTTTAGC

    GCTTAAATATGTAGATCGAACT
    miRferno
    RNA-binding protein (B6JZH8_SCHJY)
    19
    sly-miR396b
    4.5
    ch11:32027088-32027108|miR396b|ch11:32025419-32027
    Solyc11g044920.1
    +
    ExonS
    AGGTTCAACTAAACAGTGGAA

    TTCCACAGCTTTCTTGAACTT
    miRferno
    Calmodulin-like protein (Q6RZU7_MUSAC)
    20
    sly-miR396b
    4.5
    ch11:32027088-32027108|miR396b|ch11:32025778-32027
    Solyc11g044920.1
    +
    ExonS
    AGGTTCAACTAAACAGTGGAA

    TTCCACAGCTTTCTTGAACTT
    miRferno
    Calmodulin-like protein (Q6RZU7_MUSAC)
    21
    sly-miR169d
    5.5
    ch05:65387381-65387401|miR169d|ch05:65387211-65387
    Solyc05g055980.2
    -
    IntronR
    TAAGCAAGGCATATTTGGCAA

    TAGCCAAGGATGACTTGCCTA
    miRferno
    Phosphatase 2C family protein (D7L0I6_ARALY)
    22
    sly-miR169b
    5
    ch11:1605430-1605450|miR169b|ch11:1605393-1605498
    Solyc11g007170.1
    -
    ExonS
    CAGGAAAGTCATACCTAGCAA

    TAGCCAAGGATGACTTGCCTG
    miRferno
    Vacuolar sorting protein 4b (B6TLN7_MAIZE)
    23
    sly-miR6024
    5.0
    ch01:46841-46862|miR6024|ch01:46076-47010
    Solyc01g005030.2
    +
    IntronR
    GGTTAAACTGTTCTTCCTAAAA

    TTTTAGCAAGAGTTGTTTTACC
    miRferno
    Serine/threonine-protein kinase 36 (STK36_HUMAN)
    24
    sly-miR390a-3p
    4.5
    ch05:6722648-6722668|miR390a-3p|ch05:6722457-67228
    Solyc05g013500.2
    +
    IntronR
    TAAAACTCATAATGGCTGGCC

    CGCTATCCATCCTGAGTTTTA
    miRferno
    Glycosyltransferase-like protein (D8QTF3_SELML)
    25
    sly-miR9472-5p
    5.0
    ch10:649454-649474|miR9472-5p|ch10:648609-650624
    Solyc10g005840.2
    +
    AltA
    TATTCACAACTTATGCTGATG

    TTTCAGTAGACGTTGTGAATA
    miRferno
    Farnesyl pyrophosphate synthase (O65004_SOLLC)
    26
    sly-miR9472-5p
    4.0
    ch09:61655688-61655708|miR9472-5p|ch09:61655262-61
    Solyc09g064430.2
    +
    IntronR
    TATTAACAACATCTACTAAGG

    TTTCAGTAGACGTTGTGAATA
    miRferno
    Aromatic L-amino acid decarboxylase (A6BM84_ROSDA)
    27
    sly-miR9472-5p
    4.0
    ch09:61655688-61655708|miR9472-5p|ch09:61655291-61
    Solyc09g064430.2
    +
    IntronR
    TATTAACAACATCTACTAAGG

    TTTCAGTAGACGTTGTGAATA
    miRferno
    Aromatic L-amino acid decarboxylase (A6BM84_ROSDA)
    28
    sly-miR5303
    0.0
    ch11:5690278-5690298|miR5303|ch11:5690255-5692411
    Solyc11g012900.1
    -
    IntronR
    Query:1TTTTTGAAGAGTTCGAGCAAC21
    | | | | | | | | | | | | | | | | | | | | |
    Sbjct:44AAAAACTTCTCAAGCTCGTTG24
    TTTTTGAAGAGTTCGAGCAAC
    psRobot
    Small glutamine-rich tetratricopeptide repeat-containing protein A (C1BM93_OSMMO)
    29
    sly-miR5303
    0
    ch11:5692368-5692388|miR5303|ch11:5690255-5692411
    Solyc11g012900.1
    -
    IntronR
    GTTGCTCGAACTCTTCAAAAA

    TTTTTGAAGAGTTCGAGCAAC
    miRferno
    Small glutamine-rich tetratricopeptide repeat-containing protein A (C1BM93_OSMMO)
    30
    sly-miR397
    5
    ch11:5686994-5687013|miR397|ch11:5685987-5687380
    Solyc11g012900.1
    -
    IntronR
    TCATCCACGGTACACCAAAT

    ATTGAGTGCAGCGTTGATGA
    miRferno
    Small glutamine-rich tetratricopeptide repeat-containing protein A (C1BM93_OSMMO)