Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Solanum lycopersicum

Total 1573 records in 53 Pages. Current page: 1
1/53 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
sly-miR5303
1.5
ch11:3112009-3112029|miR5303|ch11:3111863-3112133
Solyc11g008960.1
-
AltD
Query:1TTTTTGAAGAGTTCGAGCAAC21
| | | | | | | | : | | | : | | | | * | | |
Sbjct:167AAAAACTTTTCAGGCTCATTG147
TTTTTGAAGAGTTCGAGCAAC
psRobot
Receptor like kinase, RLK
2
sly-miR5303
2.0
ch11:3111967-3111987|miR5303|ch11:3111863-3112133
Solyc11g008960.1
-
AltD
GTTACTCGGACTTTTCAAAAA

TTTTTGAAGAGTTCGAGCAAC
miRferno
Receptor like kinase, RLK
3
sly-miR390a-5p
5.5
ch02:41643615-41643635|miR390a-5p|ch02:41642884-41
Solyc02g072440.2
+
IntronR
GGTTCTTTACCTCCTGATTTT

AAGCTCAGGAGGGATAGCACC
miRferno
Receptor like kinase, RLK
4
sly-miR5303
3.0
ch01:2986768-2986788|miR5303|ch01:2986338-2987063
Solyc01g008970.2
-
IntronR
Query:1TTTTTGAAGAGTTCGAGCAAC21
| | | | | | | | | | : : : | | * | | | * |
Sbjct:451AAAAACTTCTTGGGCACGTCG431
TTTTTGAAGAGTTCGAGCAAC
psRobot
Heterogeneous nuclear ribonucleoprotein A3-like protein 2 (B6TV58_MAIZE)
5
sly-miR5303
3.0
ch01:2986819-2986839|miR5303|ch01:2986389-2987063
Solyc01g008970.2
-
IntronR
Query:1TTTTTGAAGAGTTCGAGCAAC21
| | | | | | | | | | : : : | | * | | | * |
Sbjct:451AAAAACTTCTTGGGCACGTCG431
TTTTTGAAGAGTTCGAGCAAC
psRobot
Heterogeneous nuclear ribonucleoprotein A3-like protein 2 (B6TV58_MAIZE)
6
sly-miR5303
3.5
ch01:2986613-2986633|miR5303|ch01:2986389-2987063
Solyc01g008970.2
-
IntronR
GCTGCACGGGTTCTTCAAAAA

TTTTTGAAGAGTTCGAGCAAC
miRferno
Heterogeneous nuclear ribonucleoprotein A3-like protein 2 (B6TV58_MAIZE)
7
sly-miR5303
3.5
ch01:2986613-2986633|miR5303|ch01:2986338-2987063
Solyc01g008970.2
-
IntronR
GCTGCACGGGTTCTTCAAAAA

TTTTTGAAGAGTTCGAGCAAC
miRferno
Heterogeneous nuclear ribonucleoprotein A3-like protein 2 (B6TV58_MAIZE)
8
sly-miR5303
3.0
ch10:2345780-2345800|miR5303|ch10:2343445-2346538
Solyc10g008240.2
+
IntronR
Query:1TTTTTGAAGAGTTCGAGCAAC21
| | | : | | | * | | | | * | : | | | | | |
Sbjct:2356AAAGACTACTCACGTTCGTTG2336
TTTTTGAAGAGTTCGAGCAAC
psRobot
Cc-nbs-lrr, resistance protein
9
sly-miR5303
3.0
ch10:2345780-2345800|miR5303|ch10:2344348-2346538
Solyc10g008240.2
+
AltA
Query:1TTTTTGAAGAGTTCGAGCAAC21
| | | : | | | * | | | | * | : | | | | | |
Sbjct:1453AAAGACTACTCACGTTCGTTG1433
TTTTTGAAGAGTTCGAGCAAC
psRobot
Cc-nbs-lrr, resistance protein
10
sly-miR5303
3.0
ch10:2345780-2345800|miR5303|ch10:2343445-2346538
Solyc10g008240.2
+
IntronR
GTTGCTTGCACTCATCAGAAA

TTTTTGAAGAGTTCGAGCAAC
miRferno
Cc-nbs-lrr, resistance protein
11
sly-miR5303
3.0
ch10:2345780-2345800|miR5303|ch10:2344348-2346538
Solyc10g008240.2
+
AltA
GTTGCTTGCACTCATCAGAAA

TTTTTGAAGAGTTCGAGCAAC
miRferno
Cc-nbs-lrr, resistance protein
12
sly-miR5303
5
ch10:2344655-2344675|miR5303|ch10:2344348-2346538
Solyc10g008240.2
+
AltA
GTTGATGGACCTCTTCACAAT

TTTTTGAAGAGTTCGAGCAAC
miRferno
Cc-nbs-lrr, resistance protein
13
sly-miR5303
5
ch10:2344655-2344675|miR5303|ch10:2343445-2346538
Solyc10g008240.2
+
IntronR
GTTGATGGACCTCTTCACAAT

TTTTTGAAGAGTTCGAGCAAC
miRferno
Cc-nbs-lrr, resistance protein
14
sly-miR9470-3p
5
ch03:2109158-2109177|miR9470-3p|ch03:2109154-21093
Solyc03g007530.2
+
AltA
ACTACTATGCATCAGCCAAA

TTTGGCTCATGGATTTTAGC
miRferno
Multidrug resistance protein ABC transporter family (B9GX56_POPTR)
15
sly-miR9471b-3p
3.0
ch07:47620185-47620204|miR9471b-3p|ch07:47620150-4
Solyc07g039510.2
-
AltA
Query:1TTGGCTGAGTGAGCATCACTG21
* | | : | | | * | | | | : | | | | | * | |
Sbjct:55TACTGACACACTTGTAGT-AC36
TTGGCTGAGTGAGCATCACTG
psRobot
Esterase/lipase/thioesterase (Fragment) (B3VW47_POPTN)
16
sly-miR9478-5p
4.5
ch02:46770589-46770610|miR9478-5p|ch02:46770167-46
Solyc02g083320.2
-
AltA
GGTTCTATCTCCATCTTTTAGC

GCTTAAATATGTAGATCGAACT
miRferno
RNA-binding protein (B6JZH8_SCHJY)
17
sly-miR9478-5p
4.5
ch02:46770589-46770610|miR9478-5p|ch02:46770167-46
Solyc02g083320.2
-
IntronR
GGTTCTATCTCCATCTTTTAGC

GCTTAAATATGTAGATCGAACT
miRferno
RNA-binding protein (B6JZH8_SCHJY)
18
sly-miR9478-5p
4.5
ch02:46770589-46770610|miR9478-5p|ch02:46770167-46
Solyc02g083320.2
-
IntronR
GGTTCTATCTCCATCTTTTAGC

GCTTAAATATGTAGATCGAACT
miRferno
RNA-binding protein (B6JZH8_SCHJY)
19
sly-miR396b
4.5
ch11:32027088-32027108|miR396b|ch11:32025419-32027
Solyc11g044920.1
+
ExonS
AGGTTCAACTAAACAGTGGAA

TTCCACAGCTTTCTTGAACTT
miRferno
Calmodulin-like protein (Q6RZU7_MUSAC)
20
sly-miR396b
4.5
ch11:32027088-32027108|miR396b|ch11:32025778-32027
Solyc11g044920.1
+
ExonS
AGGTTCAACTAAACAGTGGAA

TTCCACAGCTTTCTTGAACTT
miRferno
Calmodulin-like protein (Q6RZU7_MUSAC)
21
sly-miR169d
5.5
ch05:65387381-65387401|miR169d|ch05:65387211-65387
Solyc05g055980.2
-
IntronR
TAAGCAAGGCATATTTGGCAA

TAGCCAAGGATGACTTGCCTA
miRferno
Phosphatase 2C family protein (D7L0I6_ARALY)
22
sly-miR169b
5
ch11:1605430-1605450|miR169b|ch11:1605393-1605498
Solyc11g007170.1
-
ExonS
CAGGAAAGTCATACCTAGCAA

TAGCCAAGGATGACTTGCCTG
miRferno
Vacuolar sorting protein 4b (B6TLN7_MAIZE)
23
sly-miR6024
5.0
ch01:46841-46862|miR6024|ch01:46076-47010
Solyc01g005030.2
+
IntronR
GGTTAAACTGTTCTTCCTAAAA

TTTTAGCAAGAGTTGTTTTACC
miRferno
Serine/threonine-protein kinase 36 (STK36_HUMAN)
24
sly-miR390a-3p
4.5
ch05:6722648-6722668|miR390a-3p|ch05:6722457-67228
Solyc05g013500.2
+
IntronR
TAAAACTCATAATGGCTGGCC

CGCTATCCATCCTGAGTTTTA
miRferno
Glycosyltransferase-like protein (D8QTF3_SELML)
25
sly-miR9472-5p
5.0
ch10:649454-649474|miR9472-5p|ch10:648609-650624
Solyc10g005840.2
+
AltA
TATTCACAACTTATGCTGATG

TTTCAGTAGACGTTGTGAATA
miRferno
Farnesyl pyrophosphate synthase (O65004_SOLLC)
26
sly-miR9472-5p
4.0
ch09:61655688-61655708|miR9472-5p|ch09:61655262-61
Solyc09g064430.2
+
IntronR
TATTAACAACATCTACTAAGG

TTTCAGTAGACGTTGTGAATA
miRferno
Aromatic L-amino acid decarboxylase (A6BM84_ROSDA)
27
sly-miR9472-5p
4.0
ch09:61655688-61655708|miR9472-5p|ch09:61655291-61
Solyc09g064430.2
+
IntronR
TATTAACAACATCTACTAAGG

TTTCAGTAGACGTTGTGAATA
miRferno
Aromatic L-amino acid decarboxylase (A6BM84_ROSDA)
28
sly-miR5303
0.0
ch11:5690278-5690298|miR5303|ch11:5690255-5692411
Solyc11g012900.1
-
IntronR
Query:1TTTTTGAAGAGTTCGAGCAAC21
| | | | | | | | | | | | | | | | | | | | |
Sbjct:44AAAAACTTCTCAAGCTCGTTG24
TTTTTGAAGAGTTCGAGCAAC
psRobot
Small glutamine-rich tetratricopeptide repeat-containing protein A (C1BM93_OSMMO)
29
sly-miR5303
0
ch11:5692368-5692388|miR5303|ch11:5690255-5692411
Solyc11g012900.1
-
IntronR
GTTGCTCGAACTCTTCAAAAA

TTTTTGAAGAGTTCGAGCAAC
miRferno
Small glutamine-rich tetratricopeptide repeat-containing protein A (C1BM93_OSMMO)
30
sly-miR397
5
ch11:5686994-5687013|miR397|ch11:5685987-5687380
Solyc11g012900.1
-
IntronR
TCATCCACGGTACACCAAAT

ATTGAGTGCAGCGTTGATGA
miRferno
Small glutamine-rich tetratricopeptide repeat-containing protein A (C1BM93_OSMMO)
IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/53 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>