Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Zea mays

Total 2638 records in 88 Pages. Current page: 1
1/88 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1
zma-miR529-5p
2.8
chr5:691268-691289|miR529-5p|chr5:689692-693376
Zm00001d012811
+
IntronR
Query:1AGAAGAGAGAGAGTACAGCC-T21
* | * | | | | | | | | | | : | | | : | | * |
Sbjct:1598GCGTCTCTCTCTCGTGTTGGTA1577
AGAAGAGAGAGAGTACAGCC-T
psRobot
La-related protein 1C
2
zma-miR393b-3p
3.0
chr5:690860-690881|miR393b-3p|chr5:689692-693376
Zm00001d012811
+
IntronR
Query:1ATCAATGCGATCCTTTTGGAGG22
| | | | | : : | : | | | * | | | | : | | : |
Sbjct:1190TAGTTGTGTTAGTAAAATCTTC1169
ATCAATGCGATCCTTTTGGAGG
psRobot
La-related protein 1C
3
zma-miR398a-5p
3.0
chr8:174690011-174690030|miR398a-5p|chr8:174689929-174690926
Zm00001d012446
-
ExonS
Query:1GGGGCGAACTGAGAACACATG21
* : | | | | | * | | | | : | | | | * | | |
Sbjct:102GTCCGCTAGACTTTTGT-TAC83
GGGGCGAACTGAGAACACATG
psRobot
V-type proton ATPase subunit a1
4
zma-miR395k-3p
3.0
chr5:198085742-198085762|miR395k-3p|chr5:198085448-198085960
Zm00001d017512
+
IntronR
Query:1GTGAAGTGTTTGAGGAAACTC21
| | | * | | | | | | | | | : : | | | * | *
Sbjct:315CACATCACAAACTTTTTTTAT295
GTGAAGTGTTTGAGGAAACTC
psRobot
YbaK/aminoacyl-tRNA synthetase-associated domain
5
zma-miR396h,zma-miR396g-5p
3.0
chr8:121739524-121739543|miR396h,miR396g-5p|chr8:121739450-121744073
Zm00001d010606
+
AltA
Query:1TCCCACAGCTTTATTGAACTG21
| | | | | * | | | | | : | | | | * | * | |
Sbjct:94AGGGTATCGAAGTAACAT-AC75
TCCCACAGCTTTATTGAACTG
psRobot
Protein RETICULATA-RELATED 6 chloroplastic
6
zma-miR396h,zma-miR396g-5p
3.0
chr8:121739524-121739543|miR396h,miR396g-5p|chr8:121739310-121744073
Zm00001d010606
+
IntronR
Query:1TCCCACAGCTTTATTGAACTG21
| | | | | * | | | | | : | | | | * | * | |
Sbjct:234AGGGTATCGAAGTAACAT-AC215
TCCCACAGCTTTATTGAACTG
psRobot
Protein RETICULATA-RELATED 6 chloroplastic
7
zma-miR171b-5p
3.0
chr8:121741651-121741670|miR171b-5p|chr8:121739310-121744073
Zm00001d010606
+
IntronR
Query:1GATATTGGCGCGGTTCAATC20
| * | | : | | | | * | | : | | | | | | |
Sbjct:2361CCATGACCGGGCTAAGTTAG2342
GATATTGGCGCGGTTCAATC
psRobot
Protein RETICULATA-RELATED 6 chloroplastic
8
zma-miR171b-5p
3.0
chr8:121741651-121741670|miR171b-5p|chr8:121739450-121744073
Zm00001d010606
+
AltA
Query:1GATATTGGCGCGGTTCAATC20
| * | | : | | | | * | | : | | | | | | |
Sbjct:2221CCATGACCGGGCTAAGTTAG2202
GATATTGGCGCGGTTCAATC
psRobot
Protein RETICULATA-RELATED 6 chloroplastic
9
zma-miR164e-5p
2.8
chr1:21288663-21288683|miR164e-5p|chr1:21288480-21289262
Zm00001d028039
+
IntronR
Query:1TGGAGAAGCAGGACACGTGAG21
| | : | | | | : | | | | | | | * | | : * |
Sbjct:204ACTTCTTTGTCCTGTTCATAC184
TGGAGAAGCAGGACACGTGAG
psRobot
Probable protein S-acyltransferase 22
10
zma-miR164h-5p
2.8
chr1:21288663-21288683|miR164h-5p|chr1:21288480-21289262
Zm00001d028039
+
IntronR
Query:1TGGAGAAGCAGGGCACGTGTG21
| | : | | | | : | | | | : | | * | | : | |
Sbjct:204ACTTCTTTGTCCTGTTCATAC184
TGGAGAAGCAGGGCACGTGTG
psRobot
Probable protein S-acyltransferase 22
11
zma-miR159k-3p,zma-miR159b-3p,zma-miR159f-3p,zma-m
3.0
chr3:58482466-58482486|miR159k-3p,miR159b-3p,miR159f-3p,miR159j-3p,miR159a-3p|chr3:58482342-58482642
Zm00001d040691
+
IntronR
Query:1TTTGGATTGAAGGGAGCTCTG21
| | | | : | | | | | * | | | * | | | * | |
Sbjct:145AAACTTAACTCCCCACGATAC125
TTTGGATTGAAGGGAGCTCTG
psRobot
Probable receptor-like protein kinase
12
zma-miR399f-3p
2.8
chr1:78395029-78395049|miR399f-3p|chr1:78394592-78395263
Zm00001d029598
-
IntronR
Query:1TGCCAAAGGAAATTTGCCCCG21
* | | | | | | * | | | | | : | | | | * | :
Sbjct:458CCGGTTTACTTTAGACGGAGT438
TGCCAAAGGAAATTTGCCCCG
psRobot
Transcription initiation factor TFIID subunit 4b
13
zma-miR2275d-5p
3.0
chr3:217215710-217215729|miR2275d-5p|chr3:217215317-217215959
Zm00001d044026
+
AltA
Query:1AGAGTTGGAGGAAAGAAAACT21
| | | : * | | : | : | | | | | | | * | | |
Sbjct:413TCTTCACTTTCTTTCTT-TGA394
AGAGTTGGAGGAAAGAAAACT
psRobot
Transducin/WD40 repeat-like superfamily protein
14
zma-miR2275d-5p
3.0
chr3:217215710-217215729|miR2275d-5p|chr3:217215046-217215847
Zm00001d044026
+
IntronR
Query:1AGAGTTGGAGGAAAGAAAACT21
| | | : * | | : | : | | | | | | | * | | |
Sbjct:684TCTTCACTTTCTTTCTT-TGA665
AGAGTTGGAGGAAAGAAAACT
psRobot
Transducin/WD40 repeat-like superfamily protein
15
zma-miR2275d-5p
3.0
chr3:217215710-217215729|miR2275d-5p|chr3:217215044-217215847
Zm00001d044026
+
IntronR
Query:1AGAGTTGGAGGAAAGAAAACT21
| | | : * | | : | : | | | | | | | * | | |
Sbjct:686TCTTCACTTTCTTTCTT-TGA667
AGAGTTGGAGGAAAGAAAACT
psRobot
Transducin/WD40 repeat-like superfamily protein
16
zma-miR2275d-5p
3.0
chr3:217215710-217215729|miR2275d-5p|chr3:217215571-217215847
Zm00001d044026
+
IntronR
Query:1AGAGTTGGAGGAAAGAAAACT21
| | | : * | | : | : | | | | | | | * | | |
Sbjct:159TCTTCACTTTCTTTCTT-TGA140
AGAGTTGGAGGAAAGAAAACT
psRobot
Transducin/WD40 repeat-like superfamily protein
17
zma-miR2275d-5p
3.0
chr3:217215710-217215729|miR2275d-5p|chr3:217215031-217215862
Zm00001d044026
+
IntronR
Query:1AGAGTTGGAGGAAAGAAAACT21
| | | : * | | : | : | | | | | | | * | | |
Sbjct:699TCTTCACTTTCTTTCTT-TGA680
AGAGTTGGAGGAAAGAAAACT
psRobot
Transducin/WD40 repeat-like superfamily protein
18
zma-miR2275d-5p
3.0
chr3:217215710-217215729|miR2275d-5p|chr3:217215048-217215854
Zm00001d044026
+
IntronR
Query:1AGAGTTGGAGGAAAGAAAACT21
| | | : * | | : | : | | | | | | | * | | |
Sbjct:682TCTTCACTTTCTTTCTT-TGA663
AGAGTTGGAGGAAAGAAAACT
psRobot
Transducin/WD40 repeat-like superfamily protein
19
zma-miR2275d-5p
3.0
chr3:217215710-217215729|miR2275d-5p|chr3:217215047-217215959
Zm00001d044026
+
IntronR
Query:1AGAGTTGGAGGAAAGAAAACT21
| | | : * | | : | : | | | | | | | * | | |
Sbjct:683TCTTCACTTTCTTTCTT-TGA664
AGAGTTGGAGGAAAGAAAACT
psRobot
Transducin/WD40 repeat-like superfamily protein
20
zma-miR2275d-5p
3.0
chr3:217215710-217215729|miR2275d-5p|chr3:217215529-217215847
Zm00001d044026
+
IntronR
Query:1AGAGTTGGAGGAAAGAAAACT21
| | | : * | | : | : | | | | | | | * | | |
Sbjct:201TCTTCACTTTCTTTCTT-TGA182
AGAGTTGGAGGAAAGAAAACT
psRobot
Transducin/WD40 repeat-like superfamily protein
21
zma-miR2275c-5p
5.0
chr3:217218405-217218425|miR2275c-5p|chr3:217217071-217218743
Zm00001d044026
+
IntronR
GTTTCAAGTATTTCTAACCCT

AGGATTAGAGGGACTTGAACC
miRferno
Transducin/WD40 repeat-like superfamily protein
22
zma-miR2275c-5p
5.0
chr3:217218405-217218425|miR2275c-5p|chr3:217217499-217218493
Zm00001d044026
+
ExonS
GTTTCAAGTATTTCTAACCCT

AGGATTAGAGGGACTTGAACC
miRferno
Transducin/WD40 repeat-like superfamily protein
23
zma-miR399c-5p
5
chr7:4773129-4773149|miR399c-5p|chr7:4773109-4773272
Zm00001d018770
+
ExonS
TGAGCCAAAGCAGAAGTTCCA

GGGTACGTCTCCTTTGGCACA
miRferno
GYF domain-containing protein
24
zma-miR399c-5p
5
chr7:4773129-4773149|miR399c-5p|chr7:4772778-4773272
Zm00001d018770
+
AltD
TGAGCCAAAGCAGAAGTTCCA

GGGTACGTCTCCTTTGGCACA
miRferno
GYF domain-containing protein
25
zma-miR399c-5p
5
chr7:4773129-4773149|miR399c-5p|chr7:4772775-4773272
Zm00001d018770
+
AltD
TGAGCCAAAGCAGAAGTTCCA

GGGTACGTCTCCTTTGGCACA
miRferno
GYF domain-containing protein
26
zma-miR169o-3p
3.0
chr1:245851793-245851811|miR169o-3p|chr1:245850422-245854038
Zm00001d032989
+
IntronR
Query:1GGCAGGTCTTCTTGGCTAGC20
| | | | | | | * | | * | | | | | | * | *
Sbjct:1390CCGTCCAAAACAACCGA-CA1372
GGCAGGTCTTCTTGGCTAGC
psRobot
Serine/threonine-protein phosphatase
27
zma-miR482-3p
2.8
chr3:147927497-147927516|miR482-3p|chr3:147927277-147929485
Zm00001d042033
-
IntronR
Query:1TCTTCCTTGTTCCTCCCATT20
: | | : | | | | | | | | | : * | | * | |
Sbjct:240GGAGGGAACAAGGGAGGGAA221
TCTTCCTTGTTCCTCCCATT
psRobot
Pentatricopeptide repeat-containing protein mitochondrial
28
zma-miR482-3p
2.8
chr3:147927510-147927529|miR482-3p|chr3:147927286-147929489
Zm00001d042033
-
IntronR
Query:1TCTTCCTTGTTCCTCCCATT20
: | | : | | | | | | | | | : * | | * | |
Sbjct:244GGAGGGAACAAGGGAGGGAA225
TCTTCCTTGTTCCTCCCATT
psRobot
Pentatricopeptide repeat-containing protein mitochondrial
29
zma-miR399i-5p
5
chr5:81113560-81113580|miR399i-5p|chr5:81113513-81113780
Zm00001d015248
+
IntronR
CACGCAAGAGGAGCGGCGCAG

GTGCGGCTCTCCTCTGGCATG
miRferno
Splicing factor 3B subunit 1
30
zma-miR164g-3p
3.5
chr3:234429981-234430001|miR164g-3p|chr3:234429809-234430638
Zm00001d044667
+
IntronR
GGTGCAGGAGGCGAGCACGAG

CACGTGCTCCCCTTCTCCACC
miRferno
Nucleic acid binding protein
IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
1/88 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>