Search By Other

 Search
 Chr  
 Start  
 End  
 for  
 In different score 
 In 
       ?

ASmiR Selection

miRNA target sites locating at the linear mRNA AS regions of Zea mays

Total 2638 records in 88 Pages. Current page: 1
1/88 1 2 3 4 5 6 7 8 9 10 11 Next> Last>>

  • IDMiRnameScoreTarASregionGenomicSiteTarGeneStrandAStypeTarSeqmiRNASeqSoftwareSequence Description
    1
    zma-miR529-5p
    2.8
    chr5:691268-691289|miR529-5p|chr5:689692-693376
    Zm00001d012811
    +
    IntronR
    Query:1AGAAGAGAGAGAGTACAGCC-T21
    * | * | | | | | | | | | | : | | | : | | * |
    Sbjct:1598GCGTCTCTCTCTCGTGTTGGTA1577
    AGAAGAGAGAGAGTACAGCC-T
    psRobot
    La-related protein 1C
    2
    zma-miR393b-3p
    3.0
    chr5:690860-690881|miR393b-3p|chr5:689692-693376
    Zm00001d012811
    +
    IntronR
    Query:1ATCAATGCGATCCTTTTGGAGG22
    | | | | | : : | : | | | * | | | | : | | : |
    Sbjct:1190TAGTTGTGTTAGTAAAATCTTC1169
    ATCAATGCGATCCTTTTGGAGG
    psRobot
    La-related protein 1C
    3
    zma-miR398a-5p
    3.0
    chr8:174690011-174690030|miR398a-5p|chr8:174689929-174690926
    Zm00001d012446
    -
    ExonS
    Query:1GGGGCGAACTGAGAACACATG21
    * : | | | | | * | | | | : | | | | * | | |
    Sbjct:102GTCCGCTAGACTTTTGT-TAC83
    GGGGCGAACTGAGAACACATG
    psRobot
    V-type proton ATPase subunit a1
    4
    zma-miR395k-3p
    3.0
    chr5:198085742-198085762|miR395k-3p|chr5:198085448-198085960
    Zm00001d017512
    +
    IntronR
    Query:1GTGAAGTGTTTGAGGAAACTC21
    | | | * | | | | | | | | | : : | | | * | *
    Sbjct:315CACATCACAAACTTTTTTTAT295
    GTGAAGTGTTTGAGGAAACTC
    psRobot
    YbaK/aminoacyl-tRNA synthetase-associated domain
    5
    zma-miR396h,zma-miR396g-5p
    3.0
    chr8:121739524-121739543|miR396h,miR396g-5p|chr8:121739450-121744073
    Zm00001d010606
    +
    AltA
    Query:1TCCCACAGCTTTATTGAACTG21
    | | | | | * | | | | | : | | | | * | * | |
    Sbjct:94AGGGTATCGAAGTAACAT-AC75
    TCCCACAGCTTTATTGAACTG
    psRobot
    Protein RETICULATA-RELATED 6 chloroplastic
    6
    zma-miR396h,zma-miR396g-5p
    3.0
    chr8:121739524-121739543|miR396h,miR396g-5p|chr8:121739310-121744073
    Zm00001d010606
    +
    IntronR
    Query:1TCCCACAGCTTTATTGAACTG21
    | | | | | * | | | | | : | | | | * | * | |
    Sbjct:234AGGGTATCGAAGTAACAT-AC215
    TCCCACAGCTTTATTGAACTG
    psRobot
    Protein RETICULATA-RELATED 6 chloroplastic
    7
    zma-miR171b-5p
    3.0
    chr8:121741651-121741670|miR171b-5p|chr8:121739310-121744073
    Zm00001d010606
    +
    IntronR
    Query:1GATATTGGCGCGGTTCAATC20
    | * | | : | | | | * | | : | | | | | | |
    Sbjct:2361CCATGACCGGGCTAAGTTAG2342
    GATATTGGCGCGGTTCAATC
    psRobot
    Protein RETICULATA-RELATED 6 chloroplastic
    8
    zma-miR171b-5p
    3.0
    chr8:121741651-121741670|miR171b-5p|chr8:121739450-121744073
    Zm00001d010606
    +
    AltA
    Query:1GATATTGGCGCGGTTCAATC20
    | * | | : | | | | * | | : | | | | | | |
    Sbjct:2221CCATGACCGGGCTAAGTTAG2202
    GATATTGGCGCGGTTCAATC
    psRobot
    Protein RETICULATA-RELATED 6 chloroplastic
    9
    zma-miR164e-5p
    2.8
    chr1:21288663-21288683|miR164e-5p|chr1:21288480-21289262
    Zm00001d028039
    +
    IntronR
    Query:1TGGAGAAGCAGGACACGTGAG21
    | | : | | | | : | | | | | | | * | | : * |
    Sbjct:204ACTTCTTTGTCCTGTTCATAC184
    TGGAGAAGCAGGACACGTGAG
    psRobot
    Probable protein S-acyltransferase 22
    10
    zma-miR164h-5p
    2.8
    chr1:21288663-21288683|miR164h-5p|chr1:21288480-21289262
    Zm00001d028039
    +
    IntronR
    Query:1TGGAGAAGCAGGGCACGTGTG21
    | | : | | | | : | | | | : | | * | | : | |
    Sbjct:204ACTTCTTTGTCCTGTTCATAC184
    TGGAGAAGCAGGGCACGTGTG
    psRobot
    Probable protein S-acyltransferase 22
    11
    zma-miR159k-3p,zma-miR159b-3p,zma-miR159f-3p,zma-m
    3.0
    chr3:58482466-58482486|miR159k-3p,miR159b-3p,miR159f-3p,miR159j-3p,miR159a-3p|chr3:58482342-58482642
    Zm00001d040691
    +
    IntronR
    Query:1TTTGGATTGAAGGGAGCTCTG21
    | | | | : | | | | | * | | | * | | | * | |
    Sbjct:145AAACTTAACTCCCCACGATAC125
    TTTGGATTGAAGGGAGCTCTG
    psRobot
    Probable receptor-like protein kinase
    12
    zma-miR399f-3p
    2.8
    chr1:78395029-78395049|miR399f-3p|chr1:78394592-78395263
    Zm00001d029598
    -
    IntronR
    Query:1TGCCAAAGGAAATTTGCCCCG21
    * | | | | | | * | | | | | : | | | | * | :
    Sbjct:458CCGGTTTACTTTAGACGGAGT438
    TGCCAAAGGAAATTTGCCCCG
    psRobot
    Transcription initiation factor TFIID subunit 4b
    13
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215317-217215959
    Zm00001d044026
    +
    AltA
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:413TCTTCACTTTCTTTCTT-TGA394
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    14
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215046-217215847
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:684TCTTCACTTTCTTTCTT-TGA665
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    15
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215044-217215847
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:686TCTTCACTTTCTTTCTT-TGA667
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    16
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215571-217215847
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:159TCTTCACTTTCTTTCTT-TGA140
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    17
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215031-217215862
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:699TCTTCACTTTCTTTCTT-TGA680
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    18
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215048-217215854
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:682TCTTCACTTTCTTTCTT-TGA663
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    19
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215047-217215959
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:683TCTTCACTTTCTTTCTT-TGA664
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    20
    zma-miR2275d-5p
    3.0
    chr3:217215710-217215729|miR2275d-5p|chr3:217215529-217215847
    Zm00001d044026
    +
    IntronR
    Query:1AGAGTTGGAGGAAAGAAAACT21
    | | | : * | | : | : | | | | | | | * | | |
    Sbjct:201TCTTCACTTTCTTTCTT-TGA182
    AGAGTTGGAGGAAAGAAAACT
    psRobot
    Transducin/WD40 repeat-like superfamily protein
    21
    zma-miR2275c-5p
    5.0
    chr3:217218405-217218425|miR2275c-5p|chr3:217217071-217218743
    Zm00001d044026
    +
    IntronR
    GTTTCAAGTATTTCTAACCCT

    AGGATTAGAGGGACTTGAACC
    miRferno
    Transducin/WD40 repeat-like superfamily protein
    22
    zma-miR2275c-5p
    5.0
    chr3:217218405-217218425|miR2275c-5p|chr3:217217499-217218493
    Zm00001d044026
    +
    ExonS
    GTTTCAAGTATTTCTAACCCT

    AGGATTAGAGGGACTTGAACC
    miRferno
    Transducin/WD40 repeat-like superfamily protein
    23
    zma-miR399c-5p
    5
    chr7:4773129-4773149|miR399c-5p|chr7:4773109-4773272
    Zm00001d018770
    +
    ExonS
    TGAGCCAAAGCAGAAGTTCCA

    GGGTACGTCTCCTTTGGCACA
    miRferno
    GYF domain-containing protein
    24
    zma-miR399c-5p
    5
    chr7:4773129-4773149|miR399c-5p|chr7:4772778-4773272
    Zm00001d018770
    +
    AltD
    TGAGCCAAAGCAGAAGTTCCA

    GGGTACGTCTCCTTTGGCACA
    miRferno
    GYF domain-containing protein
    25
    zma-miR399c-5p
    5
    chr7:4773129-4773149|miR399c-5p|chr7:4772775-4773272
    Zm00001d018770
    +
    AltD
    TGAGCCAAAGCAGAAGTTCCA

    GGGTACGTCTCCTTTGGCACA
    miRferno
    GYF domain-containing protein
    26
    zma-miR169o-3p
    3.0
    chr1:245851793-245851811|miR169o-3p|chr1:245850422-245854038
    Zm00001d032989
    +
    IntronR
    Query:1GGCAGGTCTTCTTGGCTAGC20
    | | | | | | | * | | * | | | | | | * | *
    Sbjct:1390CCGTCCAAAACAACCGA-CA1372
    GGCAGGTCTTCTTGGCTAGC
    psRobot
    Serine/threonine-protein phosphatase
    27
    zma-miR482-3p
    2.8
    chr3:147927497-147927516|miR482-3p|chr3:147927277-147929485
    Zm00001d042033
    -
    IntronR
    Query:1TCTTCCTTGTTCCTCCCATT20
    : | | : | | | | | | | | | : * | | * | |
    Sbjct:240GGAGGGAACAAGGGAGGGAA221
    TCTTCCTTGTTCCTCCCATT
    psRobot
    Pentatricopeptide repeat-containing protein mitochondrial
    28
    zma-miR482-3p
    2.8
    chr3:147927510-147927529|miR482-3p|chr3:147927286-147929489
    Zm00001d042033
    -
    IntronR
    Query:1TCTTCCTTGTTCCTCCCATT20
    : | | : | | | | | | | | | : * | | * | |
    Sbjct:244GGAGGGAACAAGGGAGGGAA225
    TCTTCCTTGTTCCTCCCATT
    psRobot
    Pentatricopeptide repeat-containing protein mitochondrial
    29
    zma-miR399i-5p
    5
    chr5:81113560-81113580|miR399i-5p|chr5:81113513-81113780
    Zm00001d015248
    +
    IntronR
    CACGCAAGAGGAGCGGCGCAG

    GTGCGGCTCTCCTCTGGCATG
    miRferno
    Splicing factor 3B subunit 1
    30
    zma-miR164g-3p
    3.5
    chr3:234429981-234430001|miR164g-3p|chr3:234429809-234430638
    Zm00001d044667
    +
    IntronR
    GGTGCAGGAGGCGAGCACGAG

    CACGTGCTCCCCTTCTCCACC
    miRferno
    Nucleic acid binding protein